ID: 1102804298

View in Genome Browser
Species Human (GRCh38)
Location 12:115765790-115765812
Sequence GCACTGGTTCCTGGAAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102804298_1102804300 -8 Left 1102804298 12:115765790-115765812 CCTTCATTTCCAGGAACCAGTGC No data
Right 1102804300 12:115765805-115765827 ACCAGTGCCTCTGTGCATAGAGG No data
1102804298_1102804303 -3 Left 1102804298 12:115765790-115765812 CCTTCATTTCCAGGAACCAGTGC No data
Right 1102804303 12:115765810-115765832 TGCCTCTGTGCATAGAGGGCAGG No data
1102804298_1102804302 -7 Left 1102804298 12:115765790-115765812 CCTTCATTTCCAGGAACCAGTGC No data
Right 1102804302 12:115765806-115765828 CCAGTGCCTCTGTGCATAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102804298 Original CRISPR GCACTGGTTCCTGGAAATGA AGG (reversed) Intergenic