ID: 1102804300

View in Genome Browser
Species Human (GRCh38)
Location 12:115765805-115765827
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102804295_1102804300 25 Left 1102804295 12:115765757-115765779 CCAGGACAGTGGCTGCCGATGTT No data
Right 1102804300 12:115765805-115765827 ACCAGTGCCTCTGTGCATAGAGG No data
1102804294_1102804300 26 Left 1102804294 12:115765756-115765778 CCCAGGACAGTGGCTGCCGATGT No data
Right 1102804300 12:115765805-115765827 ACCAGTGCCTCTGTGCATAGAGG No data
1102804296_1102804300 10 Left 1102804296 12:115765772-115765794 CCGATGTTCAGCAAGCTGCCTTC No data
Right 1102804300 12:115765805-115765827 ACCAGTGCCTCTGTGCATAGAGG No data
1102804293_1102804300 27 Left 1102804293 12:115765755-115765777 CCCCAGGACAGTGGCTGCCGATG No data
Right 1102804300 12:115765805-115765827 ACCAGTGCCTCTGTGCATAGAGG No data
1102804298_1102804300 -8 Left 1102804298 12:115765790-115765812 CCTTCATTTCCAGGAACCAGTGC No data
Right 1102804300 12:115765805-115765827 ACCAGTGCCTCTGTGCATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102804300 Original CRISPR ACCAGTGCCTCTGTGCATAG AGG Intergenic