ID: 1102804516

View in Genome Browser
Species Human (GRCh38)
Location 12:115767843-115767865
Sequence GTGAACTGGATTTGGCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102804516_1102804521 11 Left 1102804516 12:115767843-115767865 CCTGTGGGCCAAATCCAGTTCAC No data
Right 1102804521 12:115767877-115767899 TGGTGTAAATAAAGTTGTATTGG No data
1102804516_1102804519 -9 Left 1102804516 12:115767843-115767865 CCTGTGGGCCAAATCCAGTTCAC No data
Right 1102804519 12:115767857-115767879 CCAGTTCACCATCTCTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102804516 Original CRISPR GTGAACTGGATTTGGCCCAC AGG (reversed) Intergenic
No off target data available for this crispr