ID: 1102804519

View in Genome Browser
Species Human (GRCh38)
Location 12:115767857-115767879
Sequence CCAGTTCACCATCTCTTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102804516_1102804519 -9 Left 1102804516 12:115767843-115767865 CCTGTGGGCCAAATCCAGTTCAC No data
Right 1102804519 12:115767857-115767879 CCAGTTCACCATCTCTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102804519 Original CRISPR CCAGTTCACCATCTCTTTAT TGG Intergenic
No off target data available for this crispr