ID: 1102805652

View in Genome Browser
Species Human (GRCh38)
Location 12:115777926-115777948
Sequence GCCCACAGCTAAACAACCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102805652_1102805655 22 Left 1102805652 12:115777926-115777948 CCATAGGTTGTTTAGCTGTGGGC No data
Right 1102805655 12:115777971-115777993 TCAGCTGACATTAGCTCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102805652 Original CRISPR GCCCACAGCTAAACAACCTA TGG (reversed) Intergenic
No off target data available for this crispr