ID: 1102806646

View in Genome Browser
Species Human (GRCh38)
Location 12:115787311-115787333
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102806642_1102806646 27 Left 1102806642 12:115787261-115787283 CCTGACAGGGTGACACCGCTCTC No data
Right 1102806646 12:115787311-115787333 GCTCCACTTTCCCGAGTTCCAGG No data
1102806644_1102806646 12 Left 1102806644 12:115787276-115787298 CCGCTCTCGTTAATATATGGAGG No data
Right 1102806646 12:115787311-115787333 GCTCCACTTTCCCGAGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102806646 Original CRISPR GCTCCACTTTCCCGAGTTCC AGG Intergenic