ID: 1102812668

View in Genome Browser
Species Human (GRCh38)
Location 12:115837942-115837964
Sequence GGCTCGTAAACATGGCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102812668_1102812685 28 Left 1102812668 12:115837942-115837964 CCCCCGGGCCATGTTTACGAGCC No data
Right 1102812685 12:115837993-115838015 CACATGTCGCCCTTTGATCAGGG No data
1102812668_1102812674 -5 Left 1102812668 12:115837942-115837964 CCCCCGGGCCATGTTTACGAGCC No data
Right 1102812674 12:115837960-115837982 GAGCCTTGCTGAGCCCTCCTGGG No data
1102812668_1102812673 -6 Left 1102812668 12:115837942-115837964 CCCCCGGGCCATGTTTACGAGCC No data
Right 1102812673 12:115837959-115837981 CGAGCCTTGCTGAGCCCTCCTGG No data
1102812668_1102812684 27 Left 1102812668 12:115837942-115837964 CCCCCGGGCCATGTTTACGAGCC No data
Right 1102812684 12:115837992-115838014 CCACATGTCGCCCTTTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102812668 Original CRISPR GGCTCGTAAACATGGCCCGG GGG (reversed) Intergenic