ID: 1102812669

View in Genome Browser
Species Human (GRCh38)
Location 12:115837943-115837965
Sequence AGGCTCGTAAACATGGCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102812669_1102812674 -6 Left 1102812669 12:115837943-115837965 CCCCGGGCCATGTTTACGAGCCT No data
Right 1102812674 12:115837960-115837982 GAGCCTTGCTGAGCCCTCCTGGG No data
1102812669_1102812684 26 Left 1102812669 12:115837943-115837965 CCCCGGGCCATGTTTACGAGCCT No data
Right 1102812684 12:115837992-115838014 CCACATGTCGCCCTTTGATCAGG No data
1102812669_1102812685 27 Left 1102812669 12:115837943-115837965 CCCCGGGCCATGTTTACGAGCCT No data
Right 1102812685 12:115837993-115838015 CACATGTCGCCCTTTGATCAGGG No data
1102812669_1102812673 -7 Left 1102812669 12:115837943-115837965 CCCCGGGCCATGTTTACGAGCCT No data
Right 1102812673 12:115837959-115837981 CGAGCCTTGCTGAGCCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102812669 Original CRISPR AGGCTCGTAAACATGGCCCG GGG (reversed) Intergenic