ID: 1102812672 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:115837950-115837972 |
| Sequence | CTCAGCAAGGCTCGTAAACA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1102812672_1102812685 | 20 | Left | 1102812672 | 12:115837950-115837972 | CCATGTTTACGAGCCTTGCTGAG | No data | ||
| Right | 1102812685 | 12:115837993-115838015 | CACATGTCGCCCTTTGATCAGGG | No data | ||||
| 1102812672_1102812684 | 19 | Left | 1102812672 | 12:115837950-115837972 | CCATGTTTACGAGCCTTGCTGAG | No data | ||
| Right | 1102812684 | 12:115837992-115838014 | CCACATGTCGCCCTTTGATCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1102812672 | Original CRISPR | CTCAGCAAGGCTCGTAAACA TGG (reversed) | Intergenic | ||