ID: 1102812672

View in Genome Browser
Species Human (GRCh38)
Location 12:115837950-115837972
Sequence CTCAGCAAGGCTCGTAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102812672_1102812685 20 Left 1102812672 12:115837950-115837972 CCATGTTTACGAGCCTTGCTGAG No data
Right 1102812685 12:115837993-115838015 CACATGTCGCCCTTTGATCAGGG No data
1102812672_1102812684 19 Left 1102812672 12:115837950-115837972 CCATGTTTACGAGCCTTGCTGAG No data
Right 1102812684 12:115837992-115838014 CCACATGTCGCCCTTTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102812672 Original CRISPR CTCAGCAAGGCTCGTAAACA TGG (reversed) Intergenic