ID: 1102812677

View in Genome Browser
Species Human (GRCh38)
Location 12:115837974-115837996
Sequence TGTGGGGGGCGCTGCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102812677_1102812684 -5 Left 1102812677 12:115837974-115837996 CCTCCTGGGCAGCGCCCCCCACA No data
Right 1102812684 12:115837992-115838014 CCACATGTCGCCCTTTGATCAGG No data
1102812677_1102812689 18 Left 1102812677 12:115837974-115837996 CCTCCTGGGCAGCGCCCCCCACA No data
Right 1102812689 12:115838015-115838037 GAAATCCAATACCTGAGGTCTGG No data
1102812677_1102812693 28 Left 1102812677 12:115837974-115837996 CCTCCTGGGCAGCGCCCCCCACA No data
Right 1102812693 12:115838025-115838047 ACCTGAGGTCTGGGCTTTATGGG No data
1102812677_1102812685 -4 Left 1102812677 12:115837974-115837996 CCTCCTGGGCAGCGCCCCCCACA No data
Right 1102812685 12:115837993-115838015 CACATGTCGCCCTTTGATCAGGG No data
1102812677_1102812692 27 Left 1102812677 12:115837974-115837996 CCTCCTGGGCAGCGCCCCCCACA No data
Right 1102812692 12:115838024-115838046 TACCTGAGGTCTGGGCTTTATGG No data
1102812677_1102812688 13 Left 1102812677 12:115837974-115837996 CCTCCTGGGCAGCGCCCCCCACA No data
Right 1102812688 12:115838010-115838032 TCAGGGAAATCCAATACCTGAGG No data
1102812677_1102812690 19 Left 1102812677 12:115837974-115837996 CCTCCTGGGCAGCGCCCCCCACA No data
Right 1102812690 12:115838016-115838038 AAATCCAATACCTGAGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102812677 Original CRISPR TGTGGGGGGCGCTGCCCAGG AGG (reversed) Intergenic