ID: 1102812679

View in Genome Browser
Species Human (GRCh38)
Location 12:115837988-115838010
Sequence ATCAAAGGGCGACATGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102812679_1102812688 -1 Left 1102812679 12:115837988-115838010 CCCCCCACATGTCGCCCTTTGAT No data
Right 1102812688 12:115838010-115838032 TCAGGGAAATCCAATACCTGAGG No data
1102812679_1102812689 4 Left 1102812679 12:115837988-115838010 CCCCCCACATGTCGCCCTTTGAT No data
Right 1102812689 12:115838015-115838037 GAAATCCAATACCTGAGGTCTGG No data
1102812679_1102812690 5 Left 1102812679 12:115837988-115838010 CCCCCCACATGTCGCCCTTTGAT No data
Right 1102812690 12:115838016-115838038 AAATCCAATACCTGAGGTCTGGG No data
1102812679_1102812693 14 Left 1102812679 12:115837988-115838010 CCCCCCACATGTCGCCCTTTGAT No data
Right 1102812693 12:115838025-115838047 ACCTGAGGTCTGGGCTTTATGGG No data
1102812679_1102812692 13 Left 1102812679 12:115837988-115838010 CCCCCCACATGTCGCCCTTTGAT No data
Right 1102812692 12:115838024-115838046 TACCTGAGGTCTGGGCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102812679 Original CRISPR ATCAAAGGGCGACATGTGGG GGG (reversed) Intergenic