ID: 1102812681

View in Genome Browser
Species Human (GRCh38)
Location 12:115837990-115838012
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102812681_1102812690 3 Left 1102812681 12:115837990-115838012 CCCCACATGTCGCCCTTTGATCA No data
Right 1102812690 12:115838016-115838038 AAATCCAATACCTGAGGTCTGGG No data
1102812681_1102812692 11 Left 1102812681 12:115837990-115838012 CCCCACATGTCGCCCTTTGATCA No data
Right 1102812692 12:115838024-115838046 TACCTGAGGTCTGGGCTTTATGG No data
1102812681_1102812689 2 Left 1102812681 12:115837990-115838012 CCCCACATGTCGCCCTTTGATCA No data
Right 1102812689 12:115838015-115838037 GAAATCCAATACCTGAGGTCTGG No data
1102812681_1102812688 -3 Left 1102812681 12:115837990-115838012 CCCCACATGTCGCCCTTTGATCA No data
Right 1102812688 12:115838010-115838032 TCAGGGAAATCCAATACCTGAGG No data
1102812681_1102812693 12 Left 1102812681 12:115837990-115838012 CCCCACATGTCGCCCTTTGATCA No data
Right 1102812693 12:115838025-115838047 ACCTGAGGTCTGGGCTTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102812681 Original CRISPR TGATCAAAGGGCGACATGTG GGG (reversed) Intergenic