ID: 1102812684

View in Genome Browser
Species Human (GRCh38)
Location 12:115837992-115838014
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102812671_1102812684 24 Left 1102812671 12:115837945-115837967 CCGGGCCATGTTTACGAGCCTTG No data
Right 1102812684 12:115837992-115838014 CCACATGTCGCCCTTTGATCAGG No data
1102812668_1102812684 27 Left 1102812668 12:115837942-115837964 CCCCCGGGCCATGTTTACGAGCC No data
Right 1102812684 12:115837992-115838014 CCACATGTCGCCCTTTGATCAGG No data
1102812669_1102812684 26 Left 1102812669 12:115837943-115837965 CCCCGGGCCATGTTTACGAGCCT No data
Right 1102812684 12:115837992-115838014 CCACATGTCGCCCTTTGATCAGG No data
1102812675_1102812684 6 Left 1102812675 12:115837963-115837985 CCTTGCTGAGCCCTCCTGGGCAG No data
Right 1102812684 12:115837992-115838014 CCACATGTCGCCCTTTGATCAGG No data
1102812670_1102812684 25 Left 1102812670 12:115837944-115837966 CCCGGGCCATGTTTACGAGCCTT No data
Right 1102812684 12:115837992-115838014 CCACATGTCGCCCTTTGATCAGG No data
1102812678_1102812684 -8 Left 1102812678 12:115837977-115837999 CCTGGGCAGCGCCCCCCACATGT No data
Right 1102812684 12:115837992-115838014 CCACATGTCGCCCTTTGATCAGG No data
1102812677_1102812684 -5 Left 1102812677 12:115837974-115837996 CCTCCTGGGCAGCGCCCCCCACA No data
Right 1102812684 12:115837992-115838014 CCACATGTCGCCCTTTGATCAGG No data
1102812676_1102812684 -4 Left 1102812676 12:115837973-115837995 CCCTCCTGGGCAGCGCCCCCCAC No data
Right 1102812684 12:115837992-115838014 CCACATGTCGCCCTTTGATCAGG No data
1102812672_1102812684 19 Left 1102812672 12:115837950-115837972 CCATGTTTACGAGCCTTGCTGAG No data
Right 1102812684 12:115837992-115838014 CCACATGTCGCCCTTTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102812684 Original CRISPR CCACATGTCGCCCTTTGATC AGG Intergenic