ID: 1102812686

View in Genome Browser
Species Human (GRCh38)
Location 12:115838002-115838024
Sequence ATTGGATTTCCCTGATCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102812686_1102812692 -1 Left 1102812686 12:115838002-115838024 CCCTTTGATCAGGGAAATCCAAT No data
Right 1102812692 12:115838024-115838046 TACCTGAGGTCTGGGCTTTATGG No data
1102812686_1102812689 -10 Left 1102812686 12:115838002-115838024 CCCTTTGATCAGGGAAATCCAAT No data
Right 1102812689 12:115838015-115838037 GAAATCCAATACCTGAGGTCTGG No data
1102812686_1102812690 -9 Left 1102812686 12:115838002-115838024 CCCTTTGATCAGGGAAATCCAAT No data
Right 1102812690 12:115838016-115838038 AAATCCAATACCTGAGGTCTGGG No data
1102812686_1102812693 0 Left 1102812686 12:115838002-115838024 CCCTTTGATCAGGGAAATCCAAT No data
Right 1102812693 12:115838025-115838047 ACCTGAGGTCTGGGCTTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102812686 Original CRISPR ATTGGATTTCCCTGATCAAA GGG (reversed) Intergenic