ID: 1102812687

View in Genome Browser
Species Human (GRCh38)
Location 12:115838003-115838025
Sequence TATTGGATTTCCCTGATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102812687_1102812693 -1 Left 1102812687 12:115838003-115838025 CCTTTGATCAGGGAAATCCAATA No data
Right 1102812693 12:115838025-115838047 ACCTGAGGTCTGGGCTTTATGGG No data
1102812687_1102812690 -10 Left 1102812687 12:115838003-115838025 CCTTTGATCAGGGAAATCCAATA No data
Right 1102812690 12:115838016-115838038 AAATCCAATACCTGAGGTCTGGG No data
1102812687_1102812692 -2 Left 1102812687 12:115838003-115838025 CCTTTGATCAGGGAAATCCAATA No data
Right 1102812692 12:115838024-115838046 TACCTGAGGTCTGGGCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102812687 Original CRISPR TATTGGATTTCCCTGATCAA AGG (reversed) Intergenic