ID: 1102812692

View in Genome Browser
Species Human (GRCh38)
Location 12:115838024-115838046
Sequence TACCTGAGGTCTGGGCTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102812679_1102812692 13 Left 1102812679 12:115837988-115838010 CCCCCCACATGTCGCCCTTTGAT No data
Right 1102812692 12:115838024-115838046 TACCTGAGGTCTGGGCTTTATGG No data
1102812676_1102812692 28 Left 1102812676 12:115837973-115837995 CCCTCCTGGGCAGCGCCCCCCAC No data
Right 1102812692 12:115838024-115838046 TACCTGAGGTCTGGGCTTTATGG No data
1102812678_1102812692 24 Left 1102812678 12:115837977-115837999 CCTGGGCAGCGCCCCCCACATGT No data
Right 1102812692 12:115838024-115838046 TACCTGAGGTCTGGGCTTTATGG No data
1102812686_1102812692 -1 Left 1102812686 12:115838002-115838024 CCCTTTGATCAGGGAAATCCAAT No data
Right 1102812692 12:115838024-115838046 TACCTGAGGTCTGGGCTTTATGG No data
1102812677_1102812692 27 Left 1102812677 12:115837974-115837996 CCTCCTGGGCAGCGCCCCCCACA No data
Right 1102812692 12:115838024-115838046 TACCTGAGGTCTGGGCTTTATGG No data
1102812680_1102812692 12 Left 1102812680 12:115837989-115838011 CCCCCACATGTCGCCCTTTGATC No data
Right 1102812692 12:115838024-115838046 TACCTGAGGTCTGGGCTTTATGG No data
1102812683_1102812692 9 Left 1102812683 12:115837992-115838014 CCACATGTCGCCCTTTGATCAGG No data
Right 1102812692 12:115838024-115838046 TACCTGAGGTCTGGGCTTTATGG No data
1102812687_1102812692 -2 Left 1102812687 12:115838003-115838025 CCTTTGATCAGGGAAATCCAATA No data
Right 1102812692 12:115838024-115838046 TACCTGAGGTCTGGGCTTTATGG No data
1102812681_1102812692 11 Left 1102812681 12:115837990-115838012 CCCCACATGTCGCCCTTTGATCA No data
Right 1102812692 12:115838024-115838046 TACCTGAGGTCTGGGCTTTATGG No data
1102812682_1102812692 10 Left 1102812682 12:115837991-115838013 CCCACATGTCGCCCTTTGATCAG No data
Right 1102812692 12:115838024-115838046 TACCTGAGGTCTGGGCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102812692 Original CRISPR TACCTGAGGTCTGGGCTTTA TGG Intergenic