ID: 1102812693

View in Genome Browser
Species Human (GRCh38)
Location 12:115838025-115838047
Sequence ACCTGAGGTCTGGGCTTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102812679_1102812693 14 Left 1102812679 12:115837988-115838010 CCCCCCACATGTCGCCCTTTGAT No data
Right 1102812693 12:115838025-115838047 ACCTGAGGTCTGGGCTTTATGGG No data
1102812686_1102812693 0 Left 1102812686 12:115838002-115838024 CCCTTTGATCAGGGAAATCCAAT No data
Right 1102812693 12:115838025-115838047 ACCTGAGGTCTGGGCTTTATGGG No data
1102812681_1102812693 12 Left 1102812681 12:115837990-115838012 CCCCACATGTCGCCCTTTGATCA No data
Right 1102812693 12:115838025-115838047 ACCTGAGGTCTGGGCTTTATGGG No data
1102812682_1102812693 11 Left 1102812682 12:115837991-115838013 CCCACATGTCGCCCTTTGATCAG No data
Right 1102812693 12:115838025-115838047 ACCTGAGGTCTGGGCTTTATGGG No data
1102812680_1102812693 13 Left 1102812680 12:115837989-115838011 CCCCCACATGTCGCCCTTTGATC No data
Right 1102812693 12:115838025-115838047 ACCTGAGGTCTGGGCTTTATGGG No data
1102812678_1102812693 25 Left 1102812678 12:115837977-115837999 CCTGGGCAGCGCCCCCCACATGT No data
Right 1102812693 12:115838025-115838047 ACCTGAGGTCTGGGCTTTATGGG No data
1102812677_1102812693 28 Left 1102812677 12:115837974-115837996 CCTCCTGGGCAGCGCCCCCCACA No data
Right 1102812693 12:115838025-115838047 ACCTGAGGTCTGGGCTTTATGGG No data
1102812676_1102812693 29 Left 1102812676 12:115837973-115837995 CCCTCCTGGGCAGCGCCCCCCAC No data
Right 1102812693 12:115838025-115838047 ACCTGAGGTCTGGGCTTTATGGG No data
1102812687_1102812693 -1 Left 1102812687 12:115838003-115838025 CCTTTGATCAGGGAAATCCAATA No data
Right 1102812693 12:115838025-115838047 ACCTGAGGTCTGGGCTTTATGGG No data
1102812683_1102812693 10 Left 1102812683 12:115837992-115838014 CCACATGTCGCCCTTTGATCAGG No data
Right 1102812693 12:115838025-115838047 ACCTGAGGTCTGGGCTTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102812693 Original CRISPR ACCTGAGGTCTGGGCTTTAT GGG Intergenic