ID: 1102818574

View in Genome Browser
Species Human (GRCh38)
Location 12:115888564-115888586
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102818574_1102818586 24 Left 1102818574 12:115888564-115888586 CCCCCTGTATGTCCTTGGGTAAC No data
Right 1102818586 12:115888611-115888633 TCTCCTCAGCTGTCTACCTGAGG No data
1102818574_1102818587 25 Left 1102818574 12:115888564-115888586 CCCCCTGTATGTCCTTGGGTAAC No data
Right 1102818587 12:115888612-115888634 CTCCTCAGCTGTCTACCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102818574 Original CRISPR GTTACCCAAGGACATACAGG GGG (reversed) Intergenic