ID: 1102818575

View in Genome Browser
Species Human (GRCh38)
Location 12:115888565-115888587
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102818575_1102818586 23 Left 1102818575 12:115888565-115888587 CCCCTGTATGTCCTTGGGTAACT No data
Right 1102818586 12:115888611-115888633 TCTCCTCAGCTGTCTACCTGAGG No data
1102818575_1102818589 30 Left 1102818575 12:115888565-115888587 CCCCTGTATGTCCTTGGGTAACT No data
Right 1102818589 12:115888618-115888640 AGCTGTCTACCTGAGGGAATTGG No data
1102818575_1102818587 24 Left 1102818575 12:115888565-115888587 CCCCTGTATGTCCTTGGGTAACT No data
Right 1102818587 12:115888612-115888634 CTCCTCAGCTGTCTACCTGAGGG 0: 1
1: 0
2: 0
3: 13
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102818575 Original CRISPR AGTTACCCAAGGACATACAG GGG (reversed) Intergenic