ID: 1102818576

View in Genome Browser
Species Human (GRCh38)
Location 12:115888566-115888588
Sequence GAGTTACCCAAGGACATACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102818576_1102818586 22 Left 1102818576 12:115888566-115888588 CCCTGTATGTCCTTGGGTAACTC No data
Right 1102818586 12:115888611-115888633 TCTCCTCAGCTGTCTACCTGAGG No data
1102818576_1102818587 23 Left 1102818576 12:115888566-115888588 CCCTGTATGTCCTTGGGTAACTC No data
Right 1102818587 12:115888612-115888634 CTCCTCAGCTGTCTACCTGAGGG No data
1102818576_1102818589 29 Left 1102818576 12:115888566-115888588 CCCTGTATGTCCTTGGGTAACTC No data
Right 1102818589 12:115888618-115888640 AGCTGTCTACCTGAGGGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102818576 Original CRISPR GAGTTACCCAAGGACATACA GGG (reversed) Intergenic