ID: 1102818581

View in Genome Browser
Species Human (GRCh38)
Location 12:115888594-115888616
Sequence AGGAGACTGGGGTCTCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102818581_1102818586 -6 Left 1102818581 12:115888594-115888616 CCCTCTTGAGACCCCAGTCTCCT No data
Right 1102818586 12:115888611-115888633 TCTCCTCAGCTGTCTACCTGAGG No data
1102818581_1102818587 -5 Left 1102818581 12:115888594-115888616 CCCTCTTGAGACCCCAGTCTCCT No data
Right 1102818587 12:115888612-115888634 CTCCTCAGCTGTCTACCTGAGGG No data
1102818581_1102818591 20 Left 1102818581 12:115888594-115888616 CCCTCTTGAGACCCCAGTCTCCT No data
Right 1102818591 12:115888637-115888659 TTGGAAGTTGACAATCTCAAAGG No data
1102818581_1102818589 1 Left 1102818581 12:115888594-115888616 CCCTCTTGAGACCCCAGTCTCCT No data
Right 1102818589 12:115888618-115888640 AGCTGTCTACCTGAGGGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102818581 Original CRISPR AGGAGACTGGGGTCTCAAGA GGG (reversed) Intergenic