ID: 1102818586

View in Genome Browser
Species Human (GRCh38)
Location 12:115888611-115888633
Sequence TCTCCTCAGCTGTCTACCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102818576_1102818586 22 Left 1102818576 12:115888566-115888588 CCCTGTATGTCCTTGGGTAACTC No data
Right 1102818586 12:115888611-115888633 TCTCCTCAGCTGTCTACCTGAGG No data
1102818582_1102818586 -7 Left 1102818582 12:115888595-115888617 CCTCTTGAGACCCCAGTCTCCTC No data
Right 1102818586 12:115888611-115888633 TCTCCTCAGCTGTCTACCTGAGG No data
1102818575_1102818586 23 Left 1102818575 12:115888565-115888587 CCCCTGTATGTCCTTGGGTAACT No data
Right 1102818586 12:115888611-115888633 TCTCCTCAGCTGTCTACCTGAGG No data
1102818580_1102818586 -5 Left 1102818580 12:115888593-115888615 CCCCTCTTGAGACCCCAGTCTCC No data
Right 1102818586 12:115888611-115888633 TCTCCTCAGCTGTCTACCTGAGG No data
1102818581_1102818586 -6 Left 1102818581 12:115888594-115888616 CCCTCTTGAGACCCCAGTCTCCT No data
Right 1102818586 12:115888611-115888633 TCTCCTCAGCTGTCTACCTGAGG No data
1102818578_1102818586 12 Left 1102818578 12:115888576-115888598 CCTTGGGTAACTCCTGTCCCCTC No data
Right 1102818586 12:115888611-115888633 TCTCCTCAGCTGTCTACCTGAGG No data
1102818577_1102818586 21 Left 1102818577 12:115888567-115888589 CCTGTATGTCCTTGGGTAACTCC No data
Right 1102818586 12:115888611-115888633 TCTCCTCAGCTGTCTACCTGAGG No data
1102818574_1102818586 24 Left 1102818574 12:115888564-115888586 CCCCCTGTATGTCCTTGGGTAAC No data
Right 1102818586 12:115888611-115888633 TCTCCTCAGCTGTCTACCTGAGG No data
1102818579_1102818586 0 Left 1102818579 12:115888588-115888610 CCTGTCCCCTCTTGAGACCCCAG No data
Right 1102818586 12:115888611-115888633 TCTCCTCAGCTGTCTACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102818586 Original CRISPR TCTCCTCAGCTGTCTACCTG AGG Intergenic
No off target data available for this crispr