ID: 1102819340

View in Genome Browser
Species Human (GRCh38)
Location 12:115894685-115894707
Sequence CAGAGCAAGGGGGAGGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102819333_1102819340 -8 Left 1102819333 12:115894670-115894692 CCAGTGTGGTTGGACCAGAGCAA No data
Right 1102819340 12:115894685-115894707 CAGAGCAAGGGGGAGGCAGCAGG No data
1102819329_1102819340 15 Left 1102819329 12:115894647-115894669 CCTGTGGAGAAATAGTGAGAAGG No data
Right 1102819340 12:115894685-115894707 CAGAGCAAGGGGGAGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102819340 Original CRISPR CAGAGCAAGGGGGAGGCAGC AGG Intergenic
No off target data available for this crispr