ID: 1102823561

View in Genome Browser
Species Human (GRCh38)
Location 12:115927597-115927619
Sequence AGTCTTCCATGCTGGCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102823561_1102823570 11 Left 1102823561 12:115927597-115927619 CCCCAGGGCCAGCATGGAAGACT No data
Right 1102823570 12:115927631-115927653 GTGATGTCTGAGCAGAGACTGGG No data
1102823561_1102823569 10 Left 1102823561 12:115927597-115927619 CCCCAGGGCCAGCATGGAAGACT No data
Right 1102823569 12:115927630-115927652 GGTGATGTCTGAGCAGAGACTGG No data
1102823561_1102823571 14 Left 1102823561 12:115927597-115927619 CCCCAGGGCCAGCATGGAAGACT No data
Right 1102823571 12:115927634-115927656 ATGTCTGAGCAGAGACTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102823561 Original CRISPR AGTCTTCCATGCTGGCCCTG GGG (reversed) Intergenic