ID: 1102823599

View in Genome Browser
Species Human (GRCh38)
Location 12:115927804-115927826
Sequence CTTGGATGGCAGAATGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102823599_1102823609 14 Left 1102823599 12:115927804-115927826 CCAGGTTCATTCTGCCATCCAAG No data
Right 1102823609 12:115927841-115927863 GACATTTGTTCCAGCCCCTCCGG No data
1102823599_1102823607 -8 Left 1102823599 12:115927804-115927826 CCAGGTTCATTCTGCCATCCAAG No data
Right 1102823607 12:115927819-115927841 CATCCAAGGGGGCAGAGAAGGGG No data
1102823599_1102823610 20 Left 1102823599 12:115927804-115927826 CCAGGTTCATTCTGCCATCCAAG No data
Right 1102823610 12:115927847-115927869 TGTTCCAGCCCCTCCGGTCCTGG No data
1102823599_1102823606 -9 Left 1102823599 12:115927804-115927826 CCAGGTTCATTCTGCCATCCAAG No data
Right 1102823606 12:115927818-115927840 CCATCCAAGGGGGCAGAGAAGGG No data
1102823599_1102823604 -10 Left 1102823599 12:115927804-115927826 CCAGGTTCATTCTGCCATCCAAG No data
Right 1102823604 12:115927817-115927839 GCCATCCAAGGGGGCAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102823599 Original CRISPR CTTGGATGGCAGAATGAACC TGG (reversed) Intergenic
No off target data available for this crispr