ID: 1102826360

View in Genome Browser
Species Human (GRCh38)
Location 12:115950742-115950764
Sequence GTGTCCTCATAGTGGTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102826354_1102826360 19 Left 1102826354 12:115950700-115950722 CCAGCTGTACAATCAGGACACTC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1102826360 12:115950742-115950764 GTGTCCTCATAGTGGTGTGGAGG 0: 1
1: 0
2: 2
3: 13
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102826360 Original CRISPR GTGTCCTCATAGTGGTGTGG AGG Intergenic
900175747 1:1290697-1290719 GAGTCCCCAAAGTGGTGGGGTGG + Intronic
901144103 1:7053632-7053654 GTGTCCCCAGAGTGGAGTGAGGG - Intronic
907245540 1:53106146-53106168 GTGACCGCACGGTGGTGTGGCGG - Intronic
907792167 1:57677527-57677549 GTGTGCACATAGTGTTGTGGCGG - Intronic
909073483 1:71025060-71025082 GTGTTCTCATTGTGGGGTGGGGG - Intronic
911303502 1:96205101-96205123 GTGTCCTCATTGCTGTGGGGAGG + Intergenic
921936618 1:220802008-220802030 GTGTCCTCAGAGCGGGGTGGTGG - Intronic
1064892351 10:20191641-20191663 GTGTTCTCATTGTTGTGGGGTGG + Intronic
1070582045 10:77728524-77728546 CTTTCCTCATAGGGGTATGGTGG - Intergenic
1072594461 10:96858553-96858575 GTTTCCTCACAGTGGTGCTGTGG + Intronic
1073224318 10:101904101-101904123 GTGTCGTCAGTGTGGTTTGGTGG - Intronic
1076593943 10:131613506-131613528 CTGTTCTCATGGTGGTGAGGAGG - Intergenic
1076772281 10:132672445-132672467 GTGTTCTCATGGTGGTGGGTGGG + Intronic
1077316628 11:1922227-1922249 GGGTCCTCAGAGGGGTGTGGTGG + Intronic
1081794757 11:45811660-45811682 CTGTCCTCAGAGTGATGTGGAGG - Exonic
1086600041 11:88622479-88622501 GTGTATTCATAGTGGTAAGGTGG - Intronic
1089681251 11:120120157-120120179 GTGCCCTCATACTTGTGGGGGGG + Intronic
1099993529 12:89752536-89752558 CTGTTCTCAGAGAGGTGTGGAGG + Intergenic
1101690864 12:107079610-107079632 GTATTCTGATAGTGGTGAGGAGG - Intronic
1102245531 12:111353461-111353483 GTGTGCTCAGAGTTGGGTGGAGG + Intergenic
1102826360 12:115950742-115950764 GTGTCCTCATAGTGGTGTGGAGG + Intergenic
1103729722 12:123019525-123019547 GTCAGCTCATAGTGGTGTGCTGG - Intronic
1103943780 12:124514996-124515018 CTGTCATCAGAGTGGCGTGGTGG - Intronic
1104598457 12:130136250-130136272 GTCTCCTCATAGTGGAGTTAGGG + Intergenic
1104815551 12:131643682-131643704 GGGTCCTCATGGAGTTGTGGGGG - Intergenic
1105851250 13:24338816-24338838 GGGCCCTCATAGTGCAGTGGGGG - Intergenic
1106775378 13:33003651-33003673 GTGTCATCAGATTGGGGTGGAGG - Intergenic
1107132628 13:36912505-36912527 GTGTATTCAAAGTGGTCTGGAGG + Intronic
1111044898 13:82802161-82802183 GTTTCCTCTTACTGGTGTGAAGG - Intergenic
1112567290 13:100562431-100562453 GTGTCCTCTGAGTGCTGTGAAGG - Intronic
1112799181 13:103092161-103092183 GTGTTCTCATGGTGGTGGGTGGG - Intergenic
1113601964 13:111575842-111575864 GTGTCCTCATATGGGGGTAGGGG + Intergenic
1113928583 13:113954426-113954448 GAGTCTTCCTAGGGGTGTGGGGG - Intergenic
1114619194 14:24084896-24084918 GTGTTCACATAGAGGGGTGGTGG - Intronic
1116221017 14:42086666-42086688 GTGTCCTTGTGGTGGGGTGGTGG + Intergenic
1118368369 14:65114944-65114966 CTGTCCTCAGATGGGTGTGGTGG + Intergenic
1119133013 14:72191956-72191978 GTGTCCTCAGGGTGGTGCGTGGG + Intronic
1127793652 15:62420168-62420190 ATGTATTCATAGTGGAGTGGTGG + Intronic
1127994659 15:64146189-64146211 GTGCCGTCAAAGTGGTGGGGTGG + Intergenic
1129036218 15:72649996-72650018 GTGTCGTCATACTGTGGTGGGGG - Intergenic
1129107150 15:73318269-73318291 GGGTGCTCATGGTGGGGTGGAGG + Intergenic
1129213671 15:74087228-74087250 GTGTCGTCATACTGTGGTGGGGG + Intergenic
1129396730 15:75253853-75253875 GTGTCATCATACTGTGGTGGGGG - Intergenic
1129400342 15:75278134-75278156 GTGTCGTCATACTGTGGTGGGGG - Intronic
1129473958 15:75770836-75770858 GTGTCATCATACTGTGGTGGGGG - Intergenic
1130045979 15:80445212-80445234 GTGTGTTGAGAGTGGTGTGGAGG + Intronic
1131187430 15:90286841-90286863 GTGTCATCATACTGTGGTGGGGG - Intronic
1131418883 15:92286732-92286754 GTGTTCTCATTGTTGTGGGGTGG + Intergenic
1131894476 15:97011348-97011370 GTGTCCTCATGGTGGAATGGAGG + Intergenic
1137543885 16:49384826-49384848 GTCTACTCATAGTCTTGTGGGGG - Intronic
1139512963 16:67437730-67437752 GTTTCCTCATAGTGAAATGGGGG + Intergenic
1139667534 16:68468281-68468303 ATGTCCACATAGTCATGTGGAGG - Intergenic
1140941062 16:79722517-79722539 TTGTCCTCATAGTGGTGTGATGG + Intergenic
1144396594 17:14849908-14849930 TTGTCCTTATAGTGATGTTGGGG - Intergenic
1145400825 17:22530933-22530955 GTGTCCTCCTAGTTGAGGGGTGG - Intergenic
1150019488 17:61596499-61596521 GTGTAATCATGGTGGGGTGGTGG - Intergenic
1150489778 17:65566341-65566363 GTCTCCTCACTATGGTGTGGAGG - Intronic
1151443438 17:74148382-74148404 ATGTCCTCATATTGGTTGGGGGG + Intergenic
1151472420 17:74326472-74326494 CTGTCCTCTCAGTGGGGTGGCGG - Intronic
1152540113 17:80970545-80970567 CTGTCCTCACAGTGGTGTGGCGG - Intergenic
1154208751 18:12360885-12360907 GTGTCCTCATGGTTGTGTAAAGG - Intronic
1156508425 18:37614430-37614452 GTGTCCTCAGATTGGGGTCGAGG + Intergenic
1158360130 18:56663071-56663093 GCGTCCTCACAGTGGTGGAGAGG + Intronic
1159494777 18:69188872-69188894 GTGTCCTCATCGTGGTGGAAAGG + Intergenic
1164599528 19:29551445-29551467 GTGTGCTTATGGTGGGGTGGGGG + Intronic
1166198296 19:41220484-41220506 GTGACCTCAGAGTGGGGTGGAGG - Intronic
1168153595 19:54461518-54461540 GTGTCCTCAGTGCGGTGTGGCGG - Exonic
1168696779 19:58408305-58408327 GTGACCTCACAGTGGAGGGGCGG - Intronic
925043962 2:756801-756823 GTGTTCTCACAGTGGGGAGGTGG - Intergenic
925908168 2:8551944-8551966 GTGCCCTGACGGTGGTGTGGTGG - Intergenic
926368390 2:12154941-12154963 GTGTCCTAATAGGTGTGTTGTGG + Intergenic
926431506 2:12790947-12790969 GTGTCTTCATTCTGGAGTGGAGG + Intergenic
926693936 2:15757542-15757564 GTGAGCTCAGAGGGGTGTGGGGG - Intergenic
927511599 2:23647548-23647570 GTGGCCTGATGGTGGGGTGGTGG - Intronic
929895838 2:45960289-45960311 GTTTCCTCATTGTGTGGTGGAGG + Intronic
937240072 2:120454401-120454423 GTGTCCTCATATGGGTGTAGTGG - Intergenic
938479166 2:131645685-131645707 GTGTCCACATGGCAGTGTGGTGG - Intergenic
938481575 2:131666964-131666986 CTGTCCTCATGGTTATGTGGGGG - Intergenic
940372855 2:152922140-152922162 GTGTCCTCATACTGGTTTGAAGG + Intergenic
941815273 2:169789922-169789944 TTGGCCACATGGTGGTGTGGTGG - Intergenic
948113208 2:235473529-235473551 ATGTCCTCACTGGGGTGTGGTGG - Intergenic
948482862 2:238261413-238261435 GTGACCTCTCAGTGGTGCGGGGG - Intronic
1172984367 20:38971423-38971445 GTGGCCTCATAATGGTGCTGGGG - Intronic
1173845695 20:46187003-46187025 TTGTCCTCATAGTAGAGAGGAGG - Intronic
1174856583 20:54051187-54051209 GTGGCCTGACAGTGGTGTGTGGG + Intronic
1175487608 20:59356610-59356632 GTTTCTTCATTGTGTTGTGGGGG + Intergenic
1175924336 20:62464684-62464706 GTCTCCACACAGTGGTGGGGAGG - Exonic
1178894367 21:36546883-36546905 ATGTCCTCTTAGGGGTGGGGAGG - Intronic
1181929435 22:26388146-26388168 GTGTCCTCATGAGGGTGTGTTGG - Intergenic
1184655539 22:45940243-45940265 GTGTCCTAATTGTGAAGTGGGGG - Intronic
1184805779 22:46794061-46794083 GTCTCCTCCTAGTGGAGTGGAGG + Intronic
950538506 3:13595531-13595553 GTGTTCTCCTGGGGGTGTGGAGG - Intronic
953208686 3:40854950-40854972 GTGTCTTGCTAGTGTTGTGGGGG - Intergenic
954777881 3:53036280-53036302 GAGTCCTCCTAGTGGAGTAGGGG - Intronic
959169800 3:102830757-102830779 GTGTCAGCAAAGTGATGTGGTGG - Intergenic
961042316 3:123686228-123686250 GTGTCCCCAAAGAAGTGTGGGGG + Intronic
961055276 3:123782608-123782630 GTATACTCAAAGTGGTGTAGGGG - Intronic
962146480 3:132845035-132845057 GTGTCCACCCAGTGGTGTGCCGG - Intergenic
965869795 3:173252206-173252228 CTGTCCTCATAGTAGTGAGTGGG - Intergenic
966492873 3:180548332-180548354 GTGTCCCCATACTTATGTGGTGG - Intergenic
966540848 3:181088200-181088222 GTGTGTTCAGAGTGGTGGGGTGG + Intergenic
967215593 3:187207339-187207361 GTGTCCTCAGAGTACTGTGCTGG + Intergenic
967923857 3:194631771-194631793 GTGTCTTCGGAGTGGTGTGTGGG - Intronic
969298222 4:6281845-6281867 CAGTCCTCAGTGTGGTGTGGGGG - Intronic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
979215588 4:118160190-118160212 ATCTCCTCATAGTGTTATGGAGG - Intronic
979628004 4:122868069-122868091 GTTTCCTTTTAGTGGTGTGTTGG + Intronic
980963503 4:139499208-139499230 TTGTCCTCATTCTTGTGTGGAGG + Intronic
985839824 5:2298025-2298047 GTGTCCCCACAGTGGTCTGCAGG + Intergenic
986750939 5:10787289-10787311 TTTACCTCATAGTGGAGTGGCGG - Intergenic
990637397 5:57744291-57744313 ATCTCCTCATAGGTGTGTGGAGG - Intergenic
999271029 5:150296510-150296532 GTGTCCTGGTACTGGTTTGGGGG + Exonic
1002775960 6:327636-327658 GTGTGCTGCTGGTGGTGTGGGGG + Intronic
1006438800 6:34040790-34040812 CTGTCCTCACAGTGGTGTCATGG + Intronic
1007626170 6:43247484-43247506 GTGTCCTCTTATTATTGTGGGGG + Intronic
1007776956 6:44229228-44229250 GTGTCCTCTTATGGGTGTGGGGG - Intronic
1009982018 6:70737645-70737667 GTGTCTTTGTAGTGCTGTGGTGG + Intronic
1010456258 6:76059179-76059201 GTGTTTTGATAGTGGGGTGGAGG + Intronic
1011808357 6:91099190-91099212 GTGTCCTGATGGTGGTGGGTGGG - Intergenic
1013374045 6:109496896-109496918 GTGTCCTCATAGTGATCCTGAGG - Intronic
1014291442 6:119563192-119563214 GATTCCTCATAGTGGTGAAGGGG - Intergenic
1015044597 6:128762327-128762349 GTGCCCACATATTGGTGGGGTGG - Intergenic
1018261887 6:161978678-161978700 GTGACCTCACAGTGGTGCAGTGG - Intronic
1018398986 6:163403643-163403665 CTGTCCTCATCGTGGTCTGTGGG - Intergenic
1021646989 7:22798347-22798369 TGGTCCCCATTGTGGTGTGGTGG + Intergenic
1027559919 7:79716892-79716914 GTGTACTTAGAGTGGTGTGCTGG - Intergenic
1028185799 7:87784665-87784687 GTGCCTTCATAGTGCTTTGGGGG + Intronic
1032094837 7:128932816-128932838 CTCTCCTCAGAGTGGTGGGGAGG - Intergenic
1032282269 7:130513732-130513754 GTGTTTTCAGAGTAGTGTGGAGG + Intronic
1032354985 7:131202698-131202720 ATGTCCCCATGGTGGAGTGGAGG + Intronic
1034997372 7:155586718-155586740 GTATCTTCACTGTGGTGTGGTGG - Intergenic
1035630309 8:1102741-1102763 GTGTCCTCACAGTTGAGAGGTGG + Intergenic
1043946434 8:86259178-86259200 GTGTCCTGGCTGTGGTGTGGAGG - Intronic
1043964758 8:86461499-86461521 GTGTCCTCATATAGCTGAGGTGG + Intronic
1046454223 8:114438263-114438285 GTGTTCTCATTGTGGGGTGGGGG - Intergenic
1048118644 8:131554589-131554611 GTGTCCCTATGGGGGTGTGGGGG - Intergenic
1049754531 8:144303954-144303976 GTGTCCTCAGCCTGCTGTGGCGG + Intronic
1050527660 9:6560088-6560110 GTGTCCACATGGTTGTTTGGAGG - Intronic
1057765171 9:97910371-97910393 GTTTCCTCTTAGTGCTATGGTGG + Exonic
1058651283 9:107177463-107177485 CTGTCCTCATAGAGGTGTAAAGG + Intergenic
1060217145 9:121745236-121745258 GTGGGCTCACTGTGGTGTGGTGG + Intronic
1060666252 9:125433685-125433707 GTGACCTCCCAGAGGTGTGGCGG - Intergenic
1061014260 9:127972849-127972871 GTGTCTGCATAGGGCTGTGGTGG - Intronic
1061374679 9:130216899-130216921 GTGTCCTCCTGGGGGTGGGGCGG + Intronic
1062066533 9:134530647-134530669 GTGTCCTCAGAGTGGCAGGGAGG + Intergenic
1188830156 X:34886601-34886623 GTGTCTTCACAGTGATGTGCTGG + Intergenic
1191616000 X:63169532-63169554 CTGTCCTGATAGTGTGGTGGTGG - Intergenic
1191620298 X:63209391-63209413 CTGTCCTGATAGTGTGGTGGTGG + Intergenic