ID: 1102827412

View in Genome Browser
Species Human (GRCh38)
Location 12:115961127-115961149
Sequence CTGAGAAGGAATCACAGTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 284}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102827412 Original CRISPR CTGAGAAGGAATCACAGTGC AGG Exonic
900563226 1:3319021-3319043 CTGAGCAGGACTCACTGGGCTGG - Intronic
900721454 1:4178554-4178576 CTGAAAAGGACTCAGAGTGATGG - Intergenic
901097834 1:6696617-6696639 CAGAGAAGGAATGAAAATGCAGG + Intronic
901521318 1:9787149-9787171 CTAAGGAGGAATGACAGGGCAGG + Intronic
901869085 1:12126984-12127006 CTGGGCAGGGATCAGAGTGCAGG - Intronic
902911771 1:19603806-19603828 ATGAGAATGAATCAGAGGGCTGG + Intronic
903022302 1:20402936-20402958 CTGAGAAAGTATCACACAGCTGG + Intergenic
903359304 1:22766863-22766885 GTGAGAAGGAACCCCAGTGTGGG + Intronic
903404595 1:23085754-23085776 ATGAGAAAGAGTCACAGTGTGGG - Exonic
903684198 1:25119161-25119183 CAAAGAAGGAACCACAGTCCTGG - Intergenic
905445602 1:38026816-38026838 CTGAGAAGGAATCCCAGCAAAGG - Intergenic
905560638 1:38924296-38924318 CTTAAAAGGAAACACAGGGCTGG + Intronic
905928235 1:41767270-41767292 CTAGGAAGGAAGCACTGTGCTGG + Intronic
906366585 1:45215287-45215309 CAGTGGAGGAATCACAGTGCAGG - Intronic
907395597 1:54187552-54187574 GTGGGAAGGAAACTCAGTGCTGG - Intronic
909581664 1:77243006-77243028 CTGTGCAGGAAGCATAGTGCTGG + Intergenic
911134833 1:94428711-94428733 CTGAGGAGGCCTCACAATGCTGG - Intronic
912586825 1:110774544-110774566 GTGGGAAGGACTCTCAGTGCTGG - Intergenic
912632132 1:111255041-111255063 CTGAGAAGGCACCTCAGAGCTGG - Intergenic
916257278 1:162802018-162802040 CTGAGAAAGAATAACATTACAGG + Intronic
917278918 1:173360730-173360752 CAGAGCAGGACTCACTGTGCGGG + Intergenic
921268254 1:213444036-213444058 CTCAGAAGGAACCACCCTGCTGG - Intergenic
922705325 1:227787555-227787577 GTGGGAAGGAATCAGAGCGCAGG + Intergenic
922966581 1:229695956-229695978 CAGAGAAGGCAGCACAGTTCAGG + Intergenic
924323162 1:242869662-242869684 CAGAGAGAGCATCACAGTGCAGG - Intergenic
1063539217 10:6915284-6915306 CTGAGTAGTAATAACAGTGATGG - Intergenic
1064010061 10:11728491-11728513 CTGTACAGGAAGCACAGTGCTGG + Intergenic
1064739278 10:18415638-18415660 CTTAGAGAGAATCACATTGCTGG - Intronic
1066135084 10:32437873-32437895 GTGAGAAGGAGTCACAGTCTTGG - Intergenic
1066723730 10:38367712-38367734 CTGAGAAAGAATAACATTACAGG + Intergenic
1067196490 10:44123953-44123975 CTGAGAAGCCATCACAGTCAAGG - Intergenic
1067761870 10:49054474-49054496 CTGAGAAGGAAGCGCAGAGGAGG + Intronic
1069142658 10:64846245-64846267 CTGAGAAGTAATTACTGTGTGGG - Intergenic
1070648246 10:78216233-78216255 CAGAGAGGGAATAACAGAGCTGG + Intergenic
1072264221 10:93712251-93712273 CTGGGCAGGAATATCAGTGCTGG + Intergenic
1072752185 10:97989145-97989167 CTTAGACTGAATCACACTGCAGG + Intronic
1074024311 10:109617911-109617933 CTAAGCATGAATCAAAGTGCTGG + Intergenic
1074366713 10:112863603-112863625 CTGAGAAGGTCTCACAGTCATGG + Intergenic
1074630553 10:115250368-115250390 CAGTGAAAGAATCACAATGCAGG - Intronic
1074824294 10:117203356-117203378 CTAAGAGGGAATCACTGTGAGGG + Intronic
1083547979 11:63563143-63563165 GTGGGAAGGAACCACGGTGCTGG - Intronic
1084697116 11:70762405-70762427 ATGAGAAGGAATGTCAGTGGTGG + Intronic
1084857891 11:72000554-72000576 CTGAGTAAGAAGCACAGTGGTGG + Exonic
1086961793 11:92985478-92985500 CCGAGAAGCATTCACAGAGCAGG - Intergenic
1087151976 11:94867551-94867573 ATGAGGAGGAATATCAGTGCAGG - Intronic
1087169106 11:95032315-95032337 CTCAGAAGGATTCACTGAGCAGG + Intergenic
1087870645 11:103289128-103289150 TGGAGATGGAATCACAGTGGGGG - Intronic
1088908922 11:114175947-114175969 CTGAGTAGGATTCACAATACTGG - Intronic
1089648460 11:119895549-119895571 CAGAGAAGAGATCACAGGGCTGG + Intergenic
1089763470 11:120745963-120745985 CAGAGCTGGAATCACAATGCTGG - Intronic
1090085657 11:123648650-123648672 CTGAGAAGGTATCATTGAGCAGG + Intronic
1090442316 11:126734760-126734782 GTGCTAAGGAATCACAGTGGTGG + Intronic
1091078418 11:132642979-132643001 CTGAGAACTAATCACATTGCTGG - Intronic
1091391340 12:128169-128191 CTGAGAGGGACACCCAGTGCAGG - Intronic
1092075223 12:5667051-5667073 CTGAGAAAGAAACACTGTCCTGG + Intronic
1092326705 12:7539921-7539943 AGGAGAAGCAATCACAGTGAAGG - Intergenic
1092591475 12:9955783-9955805 AGGAGAAGCAATCACACTGCAGG - Intronic
1093043789 12:14417871-14417893 CTGGGCAGGAATCAGAATGCTGG + Intronic
1095743854 12:45635682-45635704 CTGTGAAGGAAACACATTGGAGG + Intergenic
1095975961 12:47941459-47941481 CTGAGAAGGAATCACAGACAAGG + Intronic
1096544489 12:52328230-52328252 CTCAGGAGCACTCACAGTGCAGG + Intergenic
1098033437 12:66278346-66278368 CTATGAAGGAATCAAAGGGCAGG + Intergenic
1099442436 12:82714808-82714830 CTGAGAAGCAATCTCAGTAAAGG - Intronic
1099871263 12:88352122-88352144 GTGAGGTGGAATAACAGTGCAGG + Intergenic
1100096045 12:91038366-91038388 CTGAGGATGAAACACAGTGGGGG - Intergenic
1100409429 12:94300275-94300297 CTGAGAAGGCCTCACAGAGATGG + Intronic
1101791330 12:107930337-107930359 CTGGGAAGGAACCTCAGTGAAGG + Intergenic
1102827412 12:115961127-115961149 CTGAGAAGGAATCACAGTGCAGG + Exonic
1102960654 12:117091282-117091304 CTCAGAAGGGCTCACAGTTCTGG - Intronic
1103749820 12:123150998-123151020 CTGAGAAGGAAGCGCCGGGCGGG + Intergenic
1104417934 12:128610891-128610913 CTGAGAACGAACCACAGTGGAGG - Intronic
1104784029 12:131438308-131438330 CTGAGAGGTAATCAGTGTGCTGG + Intergenic
1105837167 13:24222182-24222204 CTGAGAAGGAAACACATTGGTGG - Intronic
1106474505 13:30086514-30086536 AGGAGAAGGAATCACGCTGCAGG + Intergenic
1106868822 13:33996732-33996754 ATGGGAAGGAAACCCAGTGCAGG + Intergenic
1107714914 13:43190568-43190590 CTAAGAATGACTCACAGTGTGGG - Intergenic
1109280014 13:60345048-60345070 CTGAGCAGGAAGCATGGTGCTGG - Intergenic
1109614391 13:64810870-64810892 CTGAGTATGATTCACAGTTCTGG + Intergenic
1110833907 13:80062936-80062958 CTAAGAAGGAGTTACAGTGTTGG - Intergenic
1111180538 13:84658114-84658136 CTGAGAAGGAAAAACGATGCAGG + Intergenic
1112759723 13:102680684-102680706 CGGAGAACGAAACACAGTGGAGG - Intergenic
1113265816 13:108616989-108617011 CTGAGATGGAATCAGAGATCAGG - Intronic
1113310199 13:109124073-109124095 ATGAGAAGGCGTCACTGTGCTGG + Intronic
1113397815 13:109964974-109964996 CTGAGAAGGCCTCACAGTCATGG - Intergenic
1113448621 13:110389538-110389560 CTGAGAAGGACTCCCTGAGCCGG - Intronic
1113649371 13:112024830-112024852 CTGAAAAGGAAGAGCAGTGCAGG - Intergenic
1113696315 13:112348685-112348707 CAAAGAAGGAATCACAGAGATGG - Intergenic
1114615697 14:24067157-24067179 CTGAGAAGGACTAATACTGCAGG - Intronic
1115472505 14:33783041-33783063 CTGGGAAGGAATTACAATGGAGG - Intronic
1116013589 14:39379953-39379975 TTGAAAAGCAATCACACTGCAGG - Intronic
1118002906 14:61540187-61540209 CTGAGAAGTACATACAGTGCAGG - Intronic
1119147023 14:72326624-72326646 CTGTACAGGAAGCACAGTGCTGG - Intronic
1119203659 14:72777842-72777864 CTGTACAGGAAGCACAGTGCTGG - Intronic
1120340813 14:83218636-83218658 CTTATCAGGAACCACAGTGCAGG - Intergenic
1120461240 14:84799022-84799044 CTGAGCAGGGATTACAGTGAAGG + Intergenic
1121493743 14:94378104-94378126 CCAAGAAGGAATCACAGGGGAGG - Exonic
1121732523 14:96196506-96196528 CTGTACAGGAAGCACAGTGCTGG + Intergenic
1121890315 14:97584076-97584098 CTGGGAAGGACTCACAGTCATGG + Intergenic
1122104946 14:99445997-99446019 GAGAGAAGGAATCACAGAACGGG + Intronic
1122530131 14:102419468-102419490 CTGTGGAGGGAACACAGTGCTGG + Intronic
1122622358 14:103066677-103066699 CAGAGAAGGGATCACTGTGCTGG + Intergenic
1202881047 14_KI270722v1_random:60557-60579 CAAAGAAGGAATCACAGCCCTGG - Intergenic
1125514035 15:40308023-40308045 CAGAGAAGGAAGCCCAGAGCAGG - Intergenic
1127625114 15:60772796-60772818 AGGAGGAGGAATCGCAGTGCAGG - Intronic
1127917740 15:63469246-63469268 ATGAGAAGCAACCACAGAGCTGG + Intergenic
1128833262 15:70788534-70788556 TTGACAATGAATCACAGTCCTGG - Intergenic
1132624875 16:886896-886918 CTGGGAAGGAAGGGCAGTGCCGG - Intronic
1133080267 16:3313227-3313249 CTGAGAAGGAACCCCAGTGAGGG + Intronic
1133279168 16:4655449-4655471 CCCAGCAGGAATCACAGAGCAGG + Intronic
1136117512 16:28104142-28104164 CAGAGTCAGAATCACAGTGCAGG + Intronic
1136585639 16:31182657-31182679 CTGAGAAAGACTCACTGTTCTGG - Exonic
1138103745 16:54275507-54275529 CTGAGAAGGAATCAAAGGAGTGG + Intergenic
1139750824 16:69107804-69107826 CTGTGAAGGAAGCACACGGCGGG + Intronic
1140028968 16:71318792-71318814 CTTAGAAGGAATCACAGGGATGG + Intergenic
1140405292 16:74706397-74706419 AAGAGAAGCAATCACAGTACAGG - Intergenic
1143665991 17:8360973-8360995 CTGAGAAGGAAGGGCAGTGGGGG - Intergenic
1144219841 17:13089818-13089840 CTGAGAAGGAATCCTGGTCCAGG + Intergenic
1145099718 17:20064481-20064503 CTGGGAGGGAAGCACAGTGTGGG + Intronic
1145103477 17:20095937-20095959 TTGCTCAGGAATCACAGTGCCGG + Intronic
1147454141 17:40524691-40524713 CTGAGAACAAAGCACATTGCAGG + Intergenic
1149721968 17:58853865-58853887 CTGAAAAGGAAAAACAATGCTGG - Intronic
1150973468 17:70057353-70057375 TTTAGAAGGGATCACAGGGCCGG + Intronic
1151495793 17:74457427-74457449 CTGAGAAGGAGGCACGGGGCTGG + Intergenic
1151524262 17:74653189-74653211 CTGAGATGGAAGCCCAGTGCTGG - Intergenic
1152171403 17:78751742-78751764 CGAAGAAGGAATCAGAGTACAGG + Intronic
1155251973 18:23961186-23961208 CTGAGCAGGAATTTGAGTGCAGG - Intergenic
1155802617 18:30127794-30127816 CTGTTCAGGAAACACAGTGCTGG - Intergenic
1156125703 18:33902733-33902755 AGGAGAAGCAATCACATTGCAGG + Intronic
1160433777 18:78830751-78830773 ATGAGAAGGATTCCCTGTGCAGG - Intergenic
1162337939 19:10073195-10073217 CAAAGAAGGAATCCCAGTGTGGG + Intergenic
1163882579 19:19939596-19939618 CTGAGAAGGAATTCCAGAGGAGG - Intergenic
1163910208 19:20182875-20182897 CTGAGAAGGAATTCCAGAGGAGG + Intronic
1163912414 19:20208686-20208708 CTGAGAAGGAATTCCAGAGAAGG - Intergenic
1163947768 19:20555852-20555874 CTGAGAAGGAATTCCAGTGAAGG - Intronic
1163970650 19:20790716-20790738 CTGAGAAGGAATTCCAGAGAAGG + Intronic
1164140235 19:22453668-22453690 CTGAAAAGGAATCCCAGGGAAGG + Intronic
1164184009 19:22845844-22845866 CTGAAAAGGAATCCCAGAGAAGG + Intergenic
1165560090 19:36671639-36671661 CAGCAGAGGAATCACAGTGCAGG + Intergenic
1166543152 19:43618999-43619021 CTGAAAGGCAAACACAGTGCTGG + Intronic
1167244306 19:48364530-48364552 CTAAGAAGGTAGCCCAGTGCCGG + Exonic
1167986279 19:53319694-53319716 GGGAGAAGCAATCACATTGCAGG - Intergenic
924976672 2:183341-183363 AAGAGAAGCAATCACACTGCAGG + Intergenic
925499170 2:4485250-4485272 CTAAGAAGGAGTTACAGTGTTGG - Intergenic
926167901 2:10532984-10533006 CTGTGAAGGCATCACAGCACAGG - Intergenic
926280849 2:11444584-11444606 CTGAGAAGGAATAATGGGGCGGG - Exonic
928169969 2:28997432-28997454 TTAAGAAGCAATGACAGTGCGGG - Intronic
931208618 2:60171448-60171470 AGGAGAAAGAATCACAGAGCGGG + Intergenic
932770514 2:74498450-74498472 CCGATAAGGGATCACAGTTCTGG - Intronic
934219477 2:90068987-90069009 CTGAGAATGCAGCACAGTGTTGG - Intergenic
935619589 2:105117122-105117144 CCCAGAAGGGAGCACAGTGCAGG + Intergenic
935813676 2:106826253-106826275 CTGTACAGGAAGCACAGTGCTGG + Intronic
939187672 2:138879743-138879765 TTGAGAAGAAATCACAAGGCAGG + Intergenic
939637360 2:144598702-144598724 CTAAAAAGGAACCACATTGCTGG - Intergenic
940094203 2:149955458-149955480 CTGAGAAGGAAGTCCAGGGCAGG + Intergenic
941662328 2:168207940-168207962 CTGAGAAGGAAGAACAGTAGTGG + Intronic
942241748 2:173968681-173968703 CAGGGAGAGAATCACAGTGCTGG + Intergenic
943295302 2:186130550-186130572 CTGAAAAGGAATCTGGGTGCTGG + Intergenic
944441980 2:199752123-199752145 GTGAGAAGGAATCACAGGGGAGG - Intergenic
944572155 2:201055762-201055784 CTTAGAAAGAAGCACAATGCTGG + Intronic
945346448 2:208723786-208723808 CTGAGATGGAATTGCAGGGCTGG - Intronic
946628728 2:221643249-221643271 CTGTACAGGAATCACAATGCTGG - Intergenic
946996040 2:225392697-225392719 CTGAGAAGGAATCACTGGGCTGG - Intergenic
948442709 2:238006100-238006122 CTGTGTAGGAAGCACGGTGCTGG + Intronic
1171267329 20:23782480-23782502 CTGAGAAGGATTTACAGGGCAGG - Intergenic
1171280185 20:23889802-23889824 CTGAGCAGGAGTTACAGGGCAGG - Intergenic
1172950308 20:38719339-38719361 CTGAGAAGGGGTCAGAGAGCGGG - Intergenic
1173456332 20:43205050-43205072 CTAGGAAGGAATGACAATGCAGG - Intergenic
1175655317 20:60764938-60764960 CAGGGAAGGAATCACAGAGTGGG - Intergenic
1175773865 20:61641076-61641098 CTGAGAGGGCAGCACAGGGCTGG - Intronic
1175881828 20:62263739-62263761 CTGGGAAGGTATTGCAGTGCTGG + Intronic
1176408508 21:6434913-6434935 CAAAGAAGGAATCACAGCCCTGG - Intergenic
1176642363 21:9318089-9318111 CAAAGAAGGAATCACAGCTCTGG - Intergenic
1178349724 21:31864109-31864131 TGAAGAAGGAAGCACAGTGCTGG + Intergenic
1179680219 21:43014807-43014829 TTGAAAAGGAATCACAGGGTGGG - Intronic
1179684001 21:43043239-43043261 CAAAGAAGGAATCACAGCCCTGG - Intergenic
1180351377 22:11807443-11807465 CAAAGAAGGAATCACAGCTCTGG - Intergenic
1180386825 22:12184634-12184656 CAAAGAAGGAATCACAGCTCTGG + Intergenic
1180858963 22:19066101-19066123 CAGACAAGGAATCAGAGGGCTGG + Intronic
1180967819 22:19799694-19799716 CAGCCAAGGAGTCACAGTGCAGG + Intronic
1181032928 22:20156972-20156994 TGGAGAAGGAAACACAGTGCTGG + Intergenic
1182713004 22:32334323-32334345 CTGACCAGGAAGGACAGTGCTGG - Intergenic
1184400268 22:44269888-44269910 CTGACCAGGAAGGACAGTGCTGG - Intronic
1184661229 22:45966451-45966473 TGGAGCAGGGATCACAGTGCGGG + Intronic
1185398120 22:50602910-50602932 CTGCGAAGGGAACACAGTGCTGG + Intronic
949324052 3:2843754-2843776 CTGTACAGGAAACACAGTGCTGG - Intronic
949892713 3:8745285-8745307 CTGTGCAGGAATCATGGTGCTGG - Intronic
951650756 3:24948893-24948915 CTGTACAGGAAGCACAGTGCTGG - Intergenic
952333906 3:32388769-32388791 ATCAGAAGTAATCACTGTGCTGG - Intergenic
952921646 3:38289393-38289415 ATGACAACGAATCACAGTGTGGG - Intronic
953735735 3:45492740-45492762 CCTAGAAGGTATCACTGTGCAGG - Intronic
954771870 3:52978129-52978151 CTGGGGAGGAATGACAGTGTGGG + Intronic
954842507 3:53524262-53524284 CTGGGAAGGATTCCCAGAGCAGG + Intronic
955413160 3:58668880-58668902 CTGGGTTGGAATCACGGTGCTGG + Intergenic
956168316 3:66413105-66413127 CAGAGGAGAAATCCCAGTGCAGG + Intronic
956291922 3:67669660-67669682 ATGAGATGAAATCACAGTGGGGG - Intergenic
958039536 3:88209434-88209456 CTGAGAAAGTCTCACAGTGGAGG - Intergenic
959276260 3:104281013-104281035 AAGAGAAGCAATCACACTGCAGG - Intergenic
959677716 3:109055331-109055353 CTATGAAGGAATCACAGAGTTGG + Intronic
959904059 3:111691427-111691449 CTGAGCCTGAATCCCAGTGCTGG - Intronic
961034702 3:123634405-123634427 CTGAGGAGGGGTCACAGTGCCGG - Intronic
961321187 3:126077800-126077822 CTGAGAAGGAAGCACGGAGGAGG - Intronic
961685352 3:128626126-128626148 CTGAGAAGGGAGCAGAGTGGAGG - Intronic
962402724 3:135075174-135075196 CTGAAAAGGAAGCCCAGGGCTGG - Intronic
962478474 3:135778264-135778286 CTGGGAAGGAACCAGAGTGATGG + Intergenic
964471542 3:157062127-157062149 TTTAGAAGGAATCAGTGTGCTGG + Intergenic
965366937 3:167812657-167812679 CTAAGCAGAAAGCACAGTGCTGG - Intronic
966983811 3:185161731-185161753 CTGAGATGAAACCACAGTCCTGG + Intergenic
967555304 3:190849847-190849869 CTGAAAAGGAATGACAGTAAAGG + Intergenic
1202744523 3_GL000221v1_random:86929-86951 CAAAGAAGGAATCACAGCTCTGG + Intergenic
968703485 4:2067418-2067440 CTGAGAAGGACACCCAGAGCAGG - Exonic
968827479 4:2910042-2910064 CACAGAGGGAATCACAGTGAGGG - Intronic
968907253 4:3460093-3460115 CTAAGAAGGAGTTACAGTGTTGG + Intergenic
969551031 4:7867261-7867283 CTGAGGAGGGATTAGAGTGCAGG + Intronic
970423323 4:15924862-15924884 CTGAGTACGTAACACAGTGCTGG + Intergenic
970794314 4:19893050-19893072 CTGAGTATCAATCACAGTGTAGG - Intergenic
971739944 4:30506666-30506688 CTGTAAGTGAATCACAGTGCAGG + Intergenic
975236510 4:72003345-72003367 AAGAGAAGGAATCACACTGCAGG + Intergenic
975521826 4:75309953-75309975 CTGTGAAGGAAGCATAATGCTGG - Intergenic
976262945 4:83163353-83163375 CTGAAAAGCAATCACTGTGAAGG + Intergenic
976388237 4:84483545-84483567 CAGAGAAGGGAACACAGTGCCGG + Intergenic
976734442 4:88296057-88296079 CAAAGAGGGAATCACAGTCCTGG + Intergenic
976833677 4:89345857-89345879 CTGTACAGGAAGCACAGTGCTGG - Intergenic
977031878 4:91893485-91893507 CTAAGAAGGAATTACAGTGTTGG + Intergenic
980123827 4:128754283-128754305 CAGAGAAGGAATCACCATGAGGG + Intergenic
981541886 4:145854554-145854576 CAGAGAAGGAATCGTTGTGCAGG - Intronic
983291258 4:165808890-165808912 ATAAGTAGGAAGCACAGTGCTGG + Intergenic
985270916 4:188194300-188194322 CTGAGAAGTAATCCCACTGTTGG - Intergenic
985815774 5:2126656-2126678 CTGAGAAGGGGACACAGTCCTGG + Intergenic
985933400 5:3077092-3077114 CTGTACAGGAAGCACAGTGCTGG - Intergenic
986043321 5:4013558-4013580 CTGACAATGAAACAAAGTGCCGG - Intergenic
986273002 5:6250329-6250351 CTGATGAGGATGCACAGTGCAGG + Intergenic
986446777 5:7828507-7828529 CTGGGAATGAGTCACAGTCCTGG - Exonic
987630506 5:20464253-20464275 CTGGGATGGAATCACAGAGAAGG - Intronic
989508086 5:42250975-42250997 CTGAGAAGGGAACACACTTCTGG + Intergenic
991565398 5:67999160-67999182 ATGAGAAGGGAACTCAGTGCAGG + Intergenic
992300215 5:75370451-75370473 CTAAAATGGAAGCACAGTGCTGG - Intronic
993140271 5:84024602-84024624 CTGACAAGGAATCAGAATCCAGG + Intronic
993542472 5:89169353-89169375 CTTAGATGGAATCACAGTCCTGG - Intergenic
993707555 5:91188280-91188302 CTGAGAGGAAATCACATTGGTGG + Intergenic
994049262 5:95344096-95344118 CTCAGAAGGAATCACCCTGCTGG - Intergenic
994058044 5:95441786-95441808 CTGAGGAGGAGGCACAGTGGAGG - Intronic
994105016 5:95937888-95937910 CTAAGAAGGTATGGCAGTGCGGG + Intronic
997815594 5:137014278-137014300 CTGAACAGGAAGCATAGTGCTGG - Intronic
999592253 5:153160861-153160883 ATGAGAAAGAATACCAGTGCAGG + Intergenic
1000086614 5:157893210-157893232 ATGTGAAGGAAGCACAGAGCGGG - Intergenic
1000278425 5:159760962-159760984 CAGACTAGGAATCACAGTTCTGG - Intergenic
1000349896 5:160345045-160345067 CTGAGAATGGAGCACAGTGTGGG - Intronic
1001116317 5:168943492-168943514 CTGAGTAGTAATCTCAGTTCTGG + Intronic
1002961129 6:1915637-1915659 CAGAGAGAGCATCACAGTGCAGG + Intronic
1003631279 6:7790018-7790040 CTGAGAAGGAGCAACAGAGCAGG - Intronic
1005926602 6:30450498-30450520 CTGGGATGGAATCTCTGTGCTGG - Intergenic
1005928318 6:30463105-30463127 CTGGGATGGAATCTCTGTGCTGG - Intergenic
1007070654 6:39035841-39035863 CTGCGATGCAATCACAGTGAAGG + Intergenic
1007824684 6:44591354-44591376 CTGAGATGGAATGACAGTTCAGG + Intergenic
1010470623 6:76223529-76223551 CTTTGAAGGAATTGCAGTGCTGG + Intergenic
1010559744 6:77334157-77334179 CTGAGAAGCAGTGACAGGGCTGG + Intergenic
1011293010 6:85796213-85796235 CTGACAAGCATTCACAGTTCAGG - Intergenic
1011448650 6:87470386-87470408 CTGTACAGGAAACACAGTGCTGG + Intronic
1013584801 6:111568839-111568861 GTGGGAAGGATTCACAGAGCAGG - Intronic
1014811861 6:125895627-125895649 CTGTGCAGGAAGCATAGTGCTGG + Intronic
1017054589 6:150425562-150425584 CAGAGAGGGAATCACAGCCCTGG - Intergenic
1017085450 6:150709035-150709057 CACAGAAGGAATTACAGGGCTGG + Intronic
1017758326 6:157548762-157548784 CTGAGGCGGCATCACAGTGACGG - Intronic
1018373450 6:163189073-163189095 CTGAGATGGAATGATACTGCAGG + Intronic
1018834448 6:167472531-167472553 CTGTGAGGGAAGCACAGTGCTGG + Intergenic
1019759620 7:2800834-2800856 CGGAGGAGGAATCACAGTGGGGG - Intronic
1019847796 7:3523975-3523997 CTGAGATGGAATCACAGGCCAGG - Intronic
1020998243 7:15292357-15292379 CTGAGAAGCAATTACATTGTCGG + Intronic
1022146779 7:27551280-27551302 TTGGAAAGAAATCACAGTGCAGG + Intronic
1022437998 7:30408602-30408624 ATGAGGAGGAAGCACAGGGCCGG - Intronic
1022652465 7:32289912-32289934 TTGAGAAGAAACCACATTGCAGG - Intronic
1023129503 7:36988176-36988198 CTGAGAAAGATTGACAGTGTTGG - Intronic
1023331153 7:39118178-39118200 CTGAGAAGGAGTCATTTTGCTGG - Intronic
1024109686 7:46132595-46132617 CTGAGAAAGCAGCACAGAGCTGG + Intergenic
1025755238 7:64332077-64332099 CTGGGAAGGGATCACAGAGAAGG + Intronic
1025816234 7:64914879-64914901 CTGAGAAGGAATCCCAGAGAAGG + Intronic
1025866389 7:65385809-65385831 CTGAGAAAGAATCCCAGAGCAGG + Intronic
1026220284 7:68390374-68390396 CTCAGAAGGAAGCACAAGGCTGG + Intergenic
1028234953 7:88349314-88349336 CTGAGAAGGCCTCACTGAGCTGG - Intergenic
1031148949 7:118030278-118030300 CTGAGAAGTAATGACATTCCTGG - Intergenic
1033549071 7:142429252-142429274 CTGTGAAGAAATGACATTGCTGG - Intergenic
1034384644 7:150729999-150730021 CTGTGCAGGAAGCACAGTGCTGG - Intronic
1038093255 8:24278431-24278453 CTGAGAATAAATCAGAGTGGTGG - Intergenic
1043484439 8:80685366-80685388 GTGACAAGGACTCACAGTACAGG - Intronic
1044945201 8:97382903-97382925 CTGTACAGGAAACACAGTGCTGG + Intergenic
1047496236 8:125410993-125411015 AGGAGAAGGAATCACAGTAAGGG - Intergenic
1048260196 8:132938706-132938728 CAGGGAAGGAATCACAGAGGAGG + Intronic
1048413307 8:134198368-134198390 CTGAGAAGGTTTTACATTGCAGG - Intergenic
1049517435 8:143068526-143068548 CTGTACAGGAAGCACAGTGCTGG - Intergenic
1050111654 9:2223063-2223085 CTGTGCAGGAAGCACAGTGCTGG + Intergenic
1050166941 9:2774858-2774880 GAGAGAAGGAATCATTGTGCTGG - Intronic
1051491878 9:17675614-17675636 CTGACAACAAATAACAGTGCTGG - Intronic
1051942908 9:22530317-22530339 CTGAGATGGAGTCACAGTGTGGG - Intergenic
1053048887 9:34942062-34942084 CCAAGAAGGAATCACAATGCAGG - Intergenic
1055595154 9:77858244-77858266 CTGCGTTGGAATCCCAGTGCTGG - Intronic
1059855538 9:118393181-118393203 CTGTATAGGAAGCACAGTGCTGG - Intergenic
1060204769 9:121675987-121676009 CTAAGCAGGAAGCACCGTGCGGG + Intronic
1060375001 9:123109623-123109645 GTGCGAAGGAGCCACAGTGCGGG + Intronic
1062499633 9:136846836-136846858 CTGAGCAGGAAGCACTCTGCCGG - Exonic
1203713154 Un_KI270742v1:116878-116900 CAAAGAAGGAATCACAGCTCTGG + Intergenic
1185506045 X:632777-632799 CTGTGTATGAATTACAGTGCCGG - Intronic
1187180770 X:16941702-16941724 CTGAGAAGGTATCACAGCTATGG + Intergenic
1187313503 X:18169266-18169288 CCCAGAAGTAATCACAGTCCTGG - Intronic
1189396381 X:40626730-40626752 CTGAGAACAAATCATATTGCTGG + Intergenic
1189576489 X:42359192-42359214 ATGAAGTGGAATCACAGTGCAGG - Intergenic
1189976164 X:46462911-46462933 CTGAGAAAGAAACACAGTACTGG - Intronic
1189982906 X:46528724-46528746 CTGAGAAAGAAACACAGTACTGG + Intronic
1190009712 X:46774090-46774112 CAGGGAAGGAATCACAGACCAGG + Intergenic
1190457294 X:50638535-50638557 CTGAGCACGTATCACAGTGCTGG + Intronic
1192313880 X:70037157-70037179 CTGAAAAGGAAACACATTTCAGG - Exonic
1192846766 X:74914404-74914426 CAGAGTTGGAATTACAGTGCTGG - Intronic
1194457180 X:94119154-94119176 CTAAGAAGGAGTTACAGTGTTGG + Intergenic
1198213767 X:134538064-134538086 CTGAGAAGCAATCTCTGTACTGG + Intergenic
1198486939 X:137096851-137096873 CTGAGAAGGTTTCACAGAGAGGG + Intergenic
1199474108 X:148227316-148227338 CAGAGAAGGGAACACAGAGCAGG - Intergenic
1199932508 X:152538046-152538068 ATGAGCAGGAATCTCAGTGTAGG - Intergenic
1200054950 X:153455422-153455444 CTGACAAGGGACCACAGGGCAGG - Intronic
1201461171 Y:14226167-14226189 CTGGGAAGGCCTCACAGTCCTGG + Intergenic
1201603563 Y:15759679-15759701 CTGTGTAGCACTCACAGTGCAGG + Intergenic