ID: 1102831544

View in Genome Browser
Species Human (GRCh38)
Location 12:116006371-116006393
Sequence ACCAAGGATGTCACTACACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102831544 Original CRISPR ACCAAGGATGTCACTACACC AGG (reversed) Exonic
907075768 1:51576666-51576688 CACAAGCATGCCACTACACCTGG + Intergenic
907777451 1:57531837-57531859 AACAAGGATGTCACTAAATATGG + Intronic
915814092 1:158948901-158948923 ACCAAGCCTGTCCCTGCACCTGG + Intronic
1065202307 10:23324873-23324895 TCCCAGGATGCCAGTACACCAGG - Intronic
1067096164 10:43302047-43302069 ACCAAGCCTGTCCCTGCACCCGG + Intergenic
1076594661 10:131618155-131618177 AACAAGCATGCCACCACACCCGG - Intergenic
1084026135 11:66450956-66450978 ACCAAGGAGGTCAGTGCAGCTGG + Intronic
1084839541 11:71833835-71833857 ACCAGGGATGACCCCACACCAGG + Intronic
1085401938 11:76240782-76240804 GCCAAGTATGTCCCTCCACCCGG - Intergenic
1094832784 12:34308107-34308129 ACCAGGGATGCCACTATACCAGG - Intergenic
1096701927 12:53390016-53390038 GCCAAGGGTGTCACTAAACTTGG + Intronic
1100400708 12:94226704-94226726 ACCAAAAATGTCACTTTACCTGG - Exonic
1100980774 12:100160723-100160745 ACCAAGGCTGTCCCTGCACCTGG + Intergenic
1102487091 12:113265894-113265916 AGCTGGGATGTCACCACACCTGG + Intronic
1102831544 12:116006371-116006393 ACCAAGGATGTCACTACACCAGG - Exonic
1110092694 13:71472632-71472654 ACAAAGAATGTCATAACACCTGG + Intronic
1114194640 14:20466387-20466409 ACCACAGATGCCACCACACCTGG + Intergenic
1114491776 14:23106881-23106903 ACCAAGAATGTAACCACACCTGG + Intergenic
1120516255 14:85474379-85474401 ACCAAGAATTTTTCTACACCTGG + Intergenic
1122037839 14:98961397-98961419 ACCAGGGATCTCACACCACCTGG - Intergenic
1122844410 14:104483786-104483808 ACCAGGCATGTCCCTCCACCTGG - Intronic
1127507087 15:59607956-59607978 ACCAAGAGTGTAACCACACCTGG - Intronic
1128811318 15:70574896-70574918 ACCATGGATGTGAATACACTTGG - Intergenic
1130677479 15:85966232-85966254 ACCAAGGCTGTGACTACGCAGGG - Intergenic
1134764105 16:16741257-16741279 ACCAAGTATGTCACAAATCCAGG - Intergenic
1138786139 16:59849026-59849048 GCCAAGGATATTACTAGACCAGG + Intergenic
1145036844 17:19546989-19547011 ACCAGAGATGTCACTGAACCTGG + Intronic
1148763814 17:50026081-50026103 ACCAGTGATCTCACCACACCTGG + Intergenic
1148979829 17:51562849-51562871 ACCAAGGATATCACTAGTGCTGG + Intergenic
1155210608 18:23597510-23597532 TCCTAGCAAGTCACTACACCTGG + Intergenic
1158399212 18:57105611-57105633 AAGAAGGATGTTACTTCACCTGG + Intergenic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1162189938 19:8936987-8937009 ACCAGTGATGTCAGCACACCTGG + Exonic
1162190114 19:8938310-8938332 ACCAAAGGGGTCACTACTCCTGG + Exonic
932866530 2:75348923-75348945 ACCAAGTATGTCACTGCAAGAGG + Intergenic
942053316 2:172161403-172161425 ACCAAGGATCCCACAACACTGGG - Intergenic
943471806 2:188303850-188303872 ACTAAGGAAGTCACCACACTGGG + Intronic
1172437788 20:34942317-34942339 ACCAAGGATCTCATTACAAGTGG + Intronic
1174257357 20:49267282-49267304 ATCAAAGATTTCACTACAGCAGG + Intronic
1178522628 21:33299281-33299303 ACAAAGGATGCCACTTCACCAGG + Intergenic
1179325166 21:40335082-40335104 ACCTAGGATGTCCCTTCCCCAGG + Intronic
1180027418 21:45175780-45175802 CCCAAGGATGGCAGCACACCTGG + Exonic
1181110829 22:20601913-20601935 ACCAAGCTTGTAACTCCACCAGG - Intergenic
952111187 3:30125263-30125285 AGCAAGAATGTAACTGCACCTGG - Intergenic
952420234 3:33123768-33123790 TACAAGCATGTGACTACACCTGG + Intronic
955876246 3:63492923-63492945 TCCGAGGCTGTCACTACAGCTGG - Intronic
962824852 3:139091397-139091419 ACAAAGGATTTCACTACTCATGG + Intronic
963836774 3:150066022-150066044 ACCAAGGATGGCACTGCACAAGG - Intergenic
965020557 3:163224105-163224127 ACCAAGCATGTAAGTACACAGGG + Intergenic
966778053 3:183560355-183560377 ACCAAACATGTCCCTTCACCGGG + Intergenic
966789873 3:183657223-183657245 AACAAGGATGGCACTAAACTGGG + Intronic
971876524 4:32316081-32316103 ACCAAGGAAATTACTACAGCGGG + Intergenic
972027153 4:34396773-34396795 ACGAAGGAGGTCACTAGACAAGG - Intergenic
974154258 4:58050608-58050630 ATCAAAGATGTCATTACATCAGG - Intergenic
980918627 4:139059560-139059582 CCCAATGATGTCATTACAACAGG + Exonic
986943650 5:12987796-12987818 ACCAGGGAGGTCACTGCAGCTGG + Intergenic
989028559 5:37092906-37092928 ACCAAGTCTGTCCCTGCACCCGG - Intergenic
989141969 5:38210464-38210486 ACCAAGGACGTCACTGTCCCTGG - Intergenic
997626679 5:135335918-135335940 ACCCAGGTTTTCACTAGACCAGG - Intronic
997863966 5:137444535-137444557 ACCAAGCAAGCCACTAGACCTGG + Intronic
998469010 5:142368786-142368808 TACAAGCATGTCACCACACCTGG + Intergenic
1005186428 6:23167338-23167360 ACCAAGCCTGTCCCTACACTTGG - Intergenic
1006255116 6:32826486-32826508 ACCACAGATGTCACTAATCCTGG - Intronic
1017230466 6:152068134-152068156 ACCAAGGATGTGGCCACAACTGG + Intronic
1028020434 7:85764728-85764750 ACCAAGCCTGTCCCTGCACCTGG - Intergenic
1028671024 7:93400119-93400141 TCCAAGGATGTCACTACTTCAGG + Intergenic
1039669191 8:39577504-39577526 ACCAAAGATGTCAGTCCACCTGG + Intergenic
1039879295 8:41614125-41614147 ACCAATGATGCCACTCAACCTGG - Intronic
1042837705 8:73092888-73092910 ACCAAGCCTGTCGCTTCACCGGG - Exonic
1046179036 8:110618560-110618582 TACAAGCATGCCACTACACCTGG + Intergenic
1046715146 8:117559017-117559039 GCCAAGGATGTCACAAAGCCAGG + Intergenic
1056571247 9:87817368-87817390 CCCAATGATGTCATTACAACAGG - Intergenic
1058851966 9:109021320-109021342 ACCAAGGCTGGCAGTACATCAGG + Intronic
1059322615 9:113481354-113481376 ACCCAGGAGGTCACCAGACCTGG + Intronic
1060796773 9:126517217-126517239 ACCAAGGAGATGACTACATCAGG + Intergenic
1062069410 9:134547481-134547503 ACCAAGGCTGTCACTCCAGGCGG - Intergenic
1188096498 X:26029793-26029815 AACAAAGATGTCACTATGCCTGG + Intergenic
1191634251 X:63359310-63359332 ACCAAGCCTGTCTCTGCACCCGG + Intergenic
1194487015 X:94497078-94497100 ACCAAGCCTGTCCCTGCACCTGG - Intergenic
1198746514 X:139896747-139896769 CCCAAGCATGCCACCACACCCGG + Intronic
1200823953 Y:7620067-7620089 ACCAAGCCTGTCCCTGCACCCGG + Intergenic
1201912236 Y:19144559-19144581 TACAGGCATGTCACTACACCTGG - Intergenic
1202236102 Y:22711021-22711043 ACCAAGCCTGTCCCTGCACCCGG - Intergenic
1202307061 Y:23485147-23485169 ACCAAGCCTGTCCCTGCACCCGG + Intergenic
1202563744 Y:26185439-26185461 ACCAAGCCTGTCCCTGCACCCGG - Intergenic