ID: 1102831568

View in Genome Browser
Species Human (GRCh38)
Location 12:116006604-116006626
Sequence CCATAGGATTGAGGGGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102831568_1102831577 23 Left 1102831568 12:116006604-116006626 CCACTTTCCCCTCAATCCTATGG 0: 1
1: 0
2: 0
3: 28
4: 244
Right 1102831577 12:116006650-116006672 TTATGCCTAAGCAGTACTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 82
1102831568_1102831576 20 Left 1102831568 12:116006604-116006626 CCACTTTCCCCTCAATCCTATGG 0: 1
1: 0
2: 0
3: 28
4: 244
Right 1102831576 12:116006647-116006669 GTTTTATGCCTAAGCAGTACTGG 0: 1
1: 0
2: 0
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102831568 Original CRISPR CCATAGGATTGAGGGGAAAG TGG (reversed) Intronic
902513760 1:16979453-16979475 CCTCAGGATTGAGAGGAAGGAGG - Intronic
902837618 1:19057401-19057423 CCCTAGGATAGAGAGGGAAGGGG + Intergenic
903301721 1:22383856-22383878 CCTTAGGACTGAGGGCAAGGAGG + Intergenic
904843259 1:33388093-33388115 CCACAGGAGAGAGGGGATAGAGG + Intronic
905529693 1:38667787-38667809 CCATAGGGCACAGGGGAAAGGGG + Intergenic
905578793 1:39067681-39067703 GCCAAGGAATGAGGGGAAAGAGG - Intergenic
906079768 1:43077582-43077604 CAATAAGAGTGAGGGGAAAAGGG - Intergenic
910899141 1:92100939-92100961 CCATAGGTTTGTGGGGGAACAGG + Intronic
911126239 1:94343537-94343559 ACATAGGATGGTGGGGGAAGAGG + Intergenic
912416339 1:109510276-109510298 GCGCAGGAGTGAGGGGAAAGGGG + Intergenic
912688305 1:111784618-111784640 CCAGAGGATTTGGTGGAAAGTGG - Intronic
915302526 1:154959576-154959598 CCATAGGATTGGGAGGGAAGGGG + Exonic
915518627 1:156428629-156428651 TCATAGGAAAGGGGGGAAAGGGG + Intronic
915613429 1:157014658-157014680 GCAGTGGATTGAGGGGTAAGTGG - Intronic
915904904 1:159870693-159870715 AGAAAGGATTGAGGAGAAAGGGG - Intronic
915989536 1:160499910-160499932 CCATGTGATTCAGAGGAAAGAGG - Intronic
917195008 1:172455765-172455787 CCAGAGGATTGAGGGGACTCAGG + Intronic
917500857 1:175583693-175583715 CTACAGGAATGAGGGGAAGGGGG - Intronic
917990928 1:180377985-180378007 CCATAAGTTTGAGGAGAAACAGG + Intronic
918849964 1:189675209-189675231 TCATAGGATTGAAGGGAAAAGGG + Intergenic
919868732 1:201804044-201804066 CCATAGTATAGAAGGGAATGGGG - Intronic
920504922 1:206508671-206508693 CCAAAGGTTTGAGGGGCCAGAGG - Intronic
920977369 1:210798453-210798475 CAAAAGGAGTGAGGGCAAAGGGG + Intronic
922745022 1:228038657-228038679 CCATAGAGTTGTGGGGACAGTGG - Intronic
923459267 1:234194572-234194594 CCATAGGTTTGAGGGGGAACAGG - Intronic
924408447 1:243777136-243777158 CCATGGGATTGGGGGGAGACGGG + Intronic
924567802 1:245212537-245212559 CCGTAGGATTGGGGGCAAAGAGG - Intronic
1064152148 10:12874152-12874174 CAAAAAGATTGAGGGGAAGGTGG - Intergenic
1065739520 10:28784556-28784578 CCATGGGATTGGGGGGAAGGAGG - Intergenic
1066205796 10:33188176-33188198 CCGTAAGATTGAGGGGACAGAGG - Intronic
1066706318 10:38182910-38182932 CCATAGGGTTTGGGGGAAACAGG + Intergenic
1066983637 10:42443151-42443173 CCATAGGTTTTGGGGGAAACAGG - Intergenic
1069684734 10:70310397-70310419 CCATGGTATTGAAGGCAAAGCGG - Intronic
1070276818 10:75015206-75015228 CCATAGGACTTATGGGAGAGAGG + Intronic
1074650561 10:115519540-115519562 CCAATGGATTCAGTGGAAAGAGG + Intronic
1075191022 10:120308622-120308644 ACACAGAGTTGAGGGGAAAGAGG + Intergenic
1075198341 10:120380180-120380202 CCCTCGGTTTGAGGGGCAAGAGG + Intergenic
1075360841 10:121832232-121832254 CCATTGGAGTGAGGAGAAATTGG - Intronic
1075841905 10:125511994-125512016 CCAAAGGATGGAGGAAAAAGAGG - Intergenic
1076148824 10:128146803-128146825 ACCTGGGAGTGAGGGGAAAGAGG - Intergenic
1076197029 10:128526224-128526246 CCATGGCAGTAAGGGGAAAGGGG - Intergenic
1076482718 10:130795462-130795484 CCCAAGAATTGAGGGGAAAGTGG - Intergenic
1076760907 10:132605351-132605373 CCCCAGGAGTGAGGGGGAAGCGG + Intronic
1078096759 11:8302241-8302263 CAATAGGTTAGAGGGGACAGGGG + Intergenic
1078859393 11:15233411-15233433 CCATAACATAGAGGGGAAAGAGG - Intronic
1078870162 11:15335941-15335963 CCATGGGTTTAAGGAGAAAGGGG + Intergenic
1079160322 11:17986374-17986396 CCTTAGGATAAAGGAGAAAGTGG + Intronic
1080924276 11:36739856-36739878 ACATGGGAGTGAGGGGATAGGGG - Intergenic
1086198691 11:84173670-84173692 GCAGAGGATTGAGGAGAGAGAGG - Intronic
1086559069 11:88146168-88146190 CCATAGGATTGAAGAGCAAGAGG + Intronic
1087528980 11:99354931-99354953 CCATAGTATTTAGGAGAGAGGGG - Intronic
1088477084 11:110251864-110251886 CCAAAGTATTGTAGGGAAAGAGG + Intronic
1088737351 11:112738675-112738697 CCAGAGGATGGAGGGGTGAGGGG - Intergenic
1088976578 11:114821639-114821661 CCTTAGGCTTGAGGATAAAGTGG + Intergenic
1089142576 11:116298520-116298542 CTAGAGTATGGAGGGGAAAGAGG - Intergenic
1089671421 11:120059644-120059666 CCAGAGGAGTCAGGGCAAAGGGG + Intergenic
1091013033 11:132023666-132023688 CACTAGAATTGAGGGGATAGAGG + Intronic
1092163291 12:6327827-6327849 CCAAAGGATTGAGGGGGCCGAGG + Exonic
1092216460 12:6687310-6687332 CCACAGGATGCAGGGTAAAGTGG - Intronic
1092290080 12:7155101-7155123 CCATGGGATTGCGAGGACAGTGG - Intronic
1094657681 12:32436640-32436662 CGATAGGATTAAAGGGAAAAGGG - Intronic
1097333315 12:58355670-58355692 TCATAGGGGTGAGGGGTAAGGGG + Intergenic
1098651563 12:72977194-72977216 CCATGGGATTTAGGGGACAGGGG - Intergenic
1099894166 12:88624057-88624079 CCTTAGGGTCCAGGGGAAAGAGG + Intergenic
1100013887 12:89985446-89985468 ACATAGGAATGGTGGGAAAGAGG - Intergenic
1100415956 12:94375118-94375140 ACATTGGGTTGAGGGGAAGGTGG + Intronic
1101311985 12:103589326-103589348 CCATAGGACAGAGCAGAAAGAGG - Intronic
1101932104 12:109023184-109023206 CACCAGGATTGAGGGAAAAGGGG - Intronic
1102831568 12:116006604-116006626 CCATAGGATTGAGGGGAAAGTGG - Intronic
1105402579 13:20109068-20109090 CCATGGTATTCAGTGGAAAGGGG - Intergenic
1105956902 13:25291968-25291990 CCCTTGTATTGAGGGGAAATGGG - Intergenic
1108147254 13:47491967-47491989 CCATGGGGGTAAGGGGAAAGGGG - Intergenic
1108177353 13:47806683-47806705 CCAGGGGCTTAAGGGGAAAGAGG + Intergenic
1109648445 13:65292039-65292061 CAATGGGATTTAGGGGAAATGGG - Intergenic
1110750289 13:79106723-79106745 CCAGAGGTTAGAGGGGAAGGGGG + Intergenic
1110879559 13:80555105-80555127 CCATAGGAGGCAGGGGAAAATGG - Intergenic
1111727611 13:92032412-92032434 CCATAGGTTTGGGGGGAAACGGG - Intronic
1111773905 13:92634747-92634769 CCTTAGGATCCAAGGGAAAGGGG - Intronic
1111900006 13:94188907-94188929 CTATACGATTGAGGGGAGAGAGG - Intronic
1113287441 13:108867449-108867471 GCATAGGATTGGGAGGAATGAGG - Intronic
1113403508 13:110017607-110017629 CCTCAGGAATGAGAGGAAAGAGG - Intergenic
1113452670 13:110422652-110422674 CCCTTGGTTTGAGGGGACAGGGG + Intronic
1114497926 14:23146764-23146786 CCATGTGACTGAGGGGAAAGAGG + Intronic
1114591770 14:23872073-23872095 CCAGAGGTTTTAGGGGAGAGAGG + Intergenic
1114898939 14:27032057-27032079 CTTTAGTATTGAGGAGAAAGGGG - Intergenic
1115291391 14:31776766-31776788 CCTCAGTATTGAGGGAAAAGGGG + Intronic
1117487428 14:56212467-56212489 CCCTGGGATTGGGGGGAGAGAGG + Intronic
1121624823 14:95375924-95375946 GCATTGGGTTGAGGGGCAAGAGG + Intergenic
1122003428 14:98683397-98683419 CTCTAGAATTGAGGGGAAAAGGG - Intergenic
1202829042 14_GL000009v2_random:5968-5990 GCATAGGAGTGAGGGGGAGGAGG - Intergenic
1124229886 15:27935419-27935441 CTTTAGGAATGAGGGAAAAGAGG - Intronic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1126098719 15:45107026-45107048 TTATAGGATAGAGGGGAAAGAGG - Intronic
1127277816 15:57462691-57462713 CCATAGGGCTTAGGGGAGAGAGG - Intronic
1128317549 15:66670699-66670721 CCACTGGAATGAGGGAAAAGTGG + Intronic
1129026537 15:72580092-72580114 CCAGAGGCTTGCGGGGATAGAGG - Intronic
1129707156 15:77801057-77801079 CCATTGGATGGAGGGGGAATTGG + Intronic
1129753476 15:78082078-78082100 CCCTAGGAATGAGGGGAGAAGGG - Intronic
1129888264 15:79053723-79053745 CCACAGGATGGAGGGCACAGAGG + Intronic
1132389745 15:101429568-101429590 CCTTAGGAATGAGGTGGAAGGGG - Intronic
1133729584 16:8568215-8568237 CCACATGATTGAGGAGAGAGAGG - Intergenic
1135066364 16:19313591-19313613 CCAAAGCAGAGAGGGGAAAGAGG + Intronic
1137494236 16:48957341-48957363 CCATAGGTTTTTGGGGAAACAGG - Intergenic
1138680605 16:58681232-58681254 CCATATGACTGAGGGGAGAGTGG - Intronic
1140981886 16:80118326-80118348 CCATAGAAATGAGGAGAAGGTGG - Intergenic
1141011470 16:80404390-80404412 TCATAGGATTGGGGGGAAGAGGG + Intergenic
1141363828 16:83423879-83423901 CCATAGGACGGAGGGAAATGGGG - Intronic
1141592496 16:85077914-85077936 CCAGGGGATGGAGGGGACAGAGG - Intronic
1141727055 16:85796626-85796648 CAATAGGATGGAGTGTAAAGGGG - Intronic
1142067517 16:88071351-88071373 CCAGTGGATTGAGTGGGAAGTGG + Intronic
1143089588 17:4441437-4441459 CCACAAGATTGAGGGGCAATTGG - Intronic
1143728154 17:8864323-8864345 CCCTAGGACTTAGGGGAAAGGGG + Intronic
1145779839 17:27555211-27555233 CCTTAGGATTGGGGGGTATGAGG + Intronic
1145837312 17:27964336-27964358 CCATAGGCTCCAGGGGCAAGAGG - Intergenic
1146767265 17:35534668-35534690 CCATTGGATTGAGATGGAAGAGG - Intronic
1147955735 17:44133299-44133321 CCAGAGGAGTCAGGGGAAGGAGG - Intergenic
1149525299 17:57350981-57351003 CCCTAGGCCTGAGGGGCAAGAGG + Intronic
1151020485 17:70611374-70611396 CCTTAGGATTGACAGTAAAGGGG - Intergenic
1153735798 18:8065678-8065700 CCTCAGGATTGTGAGGAAAGAGG + Intronic
1154991985 18:21606108-21606130 TTATACTATTGAGGGGAAAGGGG + Intergenic
1155608745 18:27638193-27638215 CCATAGTAATTATGGGAAAGGGG + Intergenic
1157408071 18:47440469-47440491 ACCTAGGAATAAGGGGAAAGGGG + Intergenic
1159313755 18:66743704-66743726 CCATAGGAATGTGGGCATAGAGG - Intergenic
1160194446 18:76740745-76740767 CCATTGGATTGGAAGGAAAGGGG - Intergenic
1160363758 18:78306863-78306885 CCATAGCAATGGGGGAAAAGAGG + Intergenic
1160614362 18:80112944-80112966 CCAGAGGATAGAGAGGATAGTGG + Intronic
1164139854 19:22449587-22449609 CAATAGGAGGAAGGGGAAAGTGG - Intronic
1164933632 19:32194674-32194696 CCATAGGATAGAAGGGAGGGGGG + Intergenic
1165297951 19:34943657-34943679 CCATATGAGTGCGGGGAATGTGG + Exonic
1168128520 19:54301135-54301157 CCATAGGTTTTTGGGGAACGTGG - Intergenic
1202643656 1_KI270706v1_random:121821-121843 GCATAGGAGTGAGGGGGAGGAGG + Intergenic
926453472 2:13036125-13036147 CCATGGGATTGAGCAGAACGAGG - Intergenic
927158512 2:20236301-20236323 CCATAGGCTGGAGGGGAGAAAGG + Intergenic
928033476 2:27800692-27800714 CCATAGGATTGTGAGACAAGGGG + Intronic
929202041 2:39245615-39245637 TCACAGTATTAAGGGGAAAGTGG - Intergenic
930430807 2:51273594-51273616 GGATAGGAAGGAGGGGAAAGGGG - Intergenic
931522711 2:63117159-63117181 CTATAGGATGCAGGGGAAATGGG - Intergenic
932027486 2:68150066-68150088 TCAGAGGTTTGAGGGGACAGCGG - Intronic
932075975 2:68663315-68663337 CCCTAGGCCTGAGGGCAAAGGGG - Intergenic
932401898 2:71486473-71486495 CCATAGGAAAGAGAGGACAGTGG - Intronic
932779432 2:74550524-74550546 GCATAAGATTGAGGGAAAATTGG + Intronic
932797047 2:74704930-74704952 CCCTTGGATTGAGGGGCAGGAGG - Intergenic
932887331 2:75560031-75560053 CCCTACTATTGAGGGGTAAGGGG - Intronic
933307676 2:80622120-80622142 GCATATGATTTAGGGGAAAGGGG - Intronic
935931365 2:108129864-108129886 CCATTGTATTGAGCTGAAAGAGG + Intergenic
937035219 2:118775472-118775494 CCAGGGGCTTGAGGGGAAAGAGG - Intergenic
939721905 2:145664016-145664038 CCATAGGTTCAAGGGGCAAGTGG - Intergenic
941207195 2:162588897-162588919 CCATTGGAGGGAGAGGAAAGAGG - Intronic
941292382 2:163693305-163693327 CCAGAGGAGTGAGGAGCAAGGGG + Intronic
941544379 2:166829756-166829778 CCAATAGGTTGAGGGGAAAGGGG - Intergenic
942418042 2:175779223-175779245 GCATAGGATTTGAGGGAAAGAGG + Intergenic
942477308 2:176341114-176341136 CCATGGGATGGTGGGGAACGGGG + Intergenic
945817557 2:214624357-214624379 CCAGAGGATTGTGGGGAAGATGG + Intergenic
946333344 2:219022485-219022507 ATATAGGATTGAGGGGATTGGGG - Intronic
946791944 2:223309812-223309834 CCATAGGCCTGAGGGCCAAGAGG + Intergenic
947378829 2:229525060-229525082 CCATGGGAATGAGGAGAGAGAGG - Intronic
948102695 2:235387881-235387903 CCCTAGGATTGGTGAGAAAGTGG - Intergenic
948641601 2:239378934-239378956 CCTTGGAAATGAGGGGAAAGAGG - Intronic
1172565492 20:35927089-35927111 CCTGAGTATTGAGGGGACAGGGG - Intronic
1172588518 20:36101617-36101639 CCCTAGGAGGGAGGGGAATGGGG - Intronic
1174035085 20:47663883-47663905 ACACAGGAAGGAGGGGAAAGGGG - Intronic
1174762153 20:53216758-53216780 CCACATGATTAAGGGGAAAGAGG - Intronic
1176260641 20:64177777-64177799 CCATGGGGCTGAGGGGAAGGTGG - Intronic
1176372890 21:6073273-6073295 CCACAGGATTTGGGGGACAGAGG - Intergenic
1176608226 21:8850807-8850829 GCATAGGAGTGAGGGGGAGGAGG - Intergenic
1178040247 21:28632980-28633002 CCATAGGAATGGGAGGAAATAGG - Intergenic
1178057943 21:28820261-28820283 GCAGAGGATTGAGAGGCAAGAGG - Intergenic
1178157599 21:29872969-29872991 CAATAAGATTGAGACGAAAGTGG + Intronic
1179750587 21:43464970-43464992 CCACAGGATTTGGGGGACAGAGG + Intergenic
1179931350 21:44572963-44572985 CCACAGGAGTGAGGGGAGCGGGG + Intronic
1180358308 22:11860612-11860634 GCATAGGAGTGAGGGGGAGGAGG - Intergenic
1180379954 22:12131718-12131740 GCATAGGAGTGAGGGGGAGGAGG + Intergenic
1182429368 22:30290953-30290975 CCATGGGGCTGAGGGGAAGGAGG + Intronic
949316905 3:2766721-2766743 CCATAGGATTTGGGGGAACAGGG - Intronic
950591170 3:13936399-13936421 CCACAGGATAAAGAGGAAAGAGG + Intergenic
950712266 3:14820790-14820812 CCACAGGATAAAGAGGAAAGAGG + Exonic
951353496 3:21635580-21635602 CCATAGGTTTGGGGGAACAGGGG + Intronic
953188653 3:40662589-40662611 GAATAGGAATGAAGGGAAAGAGG + Intergenic
956254509 3:67269698-67269720 CTGTAAGTTTGAGGGGAAAGTGG + Intergenic
958480264 3:94636613-94636635 TCATAGGGTTGGGGGGATAGGGG + Intergenic
961181640 3:124882559-124882581 GCAAAGGATCGAAGGGAAAGTGG + Intronic
961297437 3:125897677-125897699 CCTTAGGAATGAGGAGAAAAAGG + Intergenic
961542638 3:127610447-127610469 CCACAGGCTTCAGGGGAAGGTGG - Intronic
962932084 3:140048060-140048082 CCATATGACTGAGGGGAGAAAGG + Intronic
965387377 3:168060841-168060863 GCATAGGATTGATGGAAAGGTGG + Intronic
966532385 3:180995327-180995349 ACATGGGCTGGAGGGGAAAGAGG - Intergenic
966568294 3:181408582-181408604 CCATAAGGTTAAGGGGAAAAAGG - Intergenic
970733863 4:19142424-19142446 CCATAGTATTGAGAGTAGAGCGG + Intergenic
971244785 4:24917683-24917705 CCACAGGCTGGTGGGGAAAGTGG + Intronic
977593521 4:98852554-98852576 CAATTGGGATGAGGGGAAAGTGG - Intergenic
978132574 4:105216508-105216530 GGATACGATAGAGGGGAAAGGGG + Intronic
979374237 4:119926159-119926181 CCATAAGAGTGTGGGGTAAGAGG + Intergenic
979483127 4:121240887-121240909 CCATAGGTTTTAGGGGAACAGGG + Intergenic
980008776 4:127571436-127571458 GTTTAGGATTGAGGGGAGAGAGG - Intergenic
981529461 4:145737808-145737830 CCAGAGCATTGAGGTGAAAAAGG - Intronic
982293431 4:153802988-153803010 CCAAAGGAAGGAGGGGACAGAGG + Intergenic
982582932 4:157202148-157202170 CCATAAGACTCAGTGGAAAGGGG + Intergenic
985247029 4:187989277-187989299 TCATAAGATGGAGGGGAAAAGGG + Intergenic
1202771022 4_GL000008v2_random:207734-207756 GCATAGGAGTGAGGGGGAGGAGG + Intergenic
985593665 5:778055-778077 CCGTAGGACAGAGGGGCAAGGGG + Intergenic
990742528 5:58926698-58926720 ACACAGGCTTCAGGGGAAAGAGG + Intergenic
991705780 5:69357064-69357086 CCAAAATATTAAGGGGAAAGAGG - Intronic
992000604 5:72432491-72432513 ACACAGAATTGCGGGGAAAGAGG + Intergenic
992895269 5:81240040-81240062 GCATTGGAGGGAGGGGAAAGAGG - Intronic
995752436 5:115467514-115467536 ACATGGGATTGAGGAGACAGGGG + Intergenic
996128812 5:119755997-119756019 CCATAGGATTTTGGGGGAACAGG - Intergenic
1003346276 6:5270827-5270849 CCCCAGGGTAGAGGGGAAAGAGG - Intronic
1003563584 6:7203779-7203801 CCCTAGTATTGCAGGGAAAGTGG + Intronic
1004241159 6:13924293-13924315 CCGTAGGAGAGAGGGGAAAGGGG - Intergenic
1005206221 6:23408266-23408288 GCAGAAGGTTGAGGGGAAAGAGG + Intergenic
1005959105 6:30683835-30683857 TCCTAGGATGGAGGGGAGAGGGG - Intronic
1008423051 6:51325029-51325051 CCTCAGGATTGAGGGCAAAGGGG + Intergenic
1010141546 6:72620421-72620443 CCAGAGGCTTGGGGGGAAGGAGG + Intergenic
1014009463 6:116459698-116459720 CCATAGGAATGAGGTGAAGGAGG + Intergenic
1014222065 6:118807588-118807610 CCAGAGGAATGAGGGGCAAAGGG + Intergenic
1014943645 6:127472319-127472341 CTTTAGGTTTGAGGAGAAAGGGG + Intronic
1015621344 6:135135185-135135207 TCATATGTTTGAGGGAAAAGAGG + Intergenic
1016282958 6:142440159-142440181 CTATAGGATTCGGGGGAAAACGG + Intronic
1017524058 6:155227367-155227389 CAATAGGGTTGTGGGGAAAACGG - Intronic
1017905523 6:158755361-158755383 CCATAGACTTGAGGGAAAACTGG + Intronic
1019116589 6:169769103-169769125 CCACAGGTTTTAGGGAAAAGAGG - Intronic
1020433691 7:8139505-8139527 CCAAAGGCTTGAGGGGAGGGAGG + Intronic
1021044987 7:15911884-15911906 CCCAAGGAATGAGGAGAAAGAGG + Intergenic
1021048728 7:15955987-15956009 TCATGGGGTTGGGGGGAAAGGGG - Intergenic
1027541782 7:79476253-79476275 GTATAGGAGTGAGGGGAAAAGGG - Intergenic
1027869937 7:83694231-83694253 GCATAAAATTGAGGGGAAAAAGG - Intergenic
1029530608 7:101122744-101122766 ACTTAGGATTCAGGGGAAAAGGG + Intergenic
1030625344 7:111839842-111839864 CCATAGGTTTTTGGGGAAACAGG + Intronic
1033564116 7:142562140-142562162 CCATGGGATTGATGGGTAAGAGG - Intergenic
1033802099 7:144913359-144913381 GCTTAGGGTTGAGGGGAGAGGGG + Intergenic
1034534950 7:151720782-151720804 ACAGGGGATTGAGGGGAGAGAGG + Intronic
1034595832 7:152190798-152190820 CAATAGAATTGATGAGAAAGGGG - Intronic
1035293936 7:157857274-157857296 CCATAGGCTTGAGGGAAAACAGG - Intronic
1036926308 8:12909446-12909468 CCAAGGGATTGAGGGGATGGCGG + Intergenic
1038229554 8:25687614-25687636 CCACAGGAATGAGGGTAAACTGG - Intergenic
1039024030 8:33238303-33238325 CAATAGGAGTGATGGGAAGGGGG + Intergenic
1040858350 8:51973439-51973461 CCTGGGGATTGAGGGGAAACTGG - Intergenic
1040896700 8:52375633-52375655 CCATGGCATTGAGGATAAAGAGG - Intronic
1041197383 8:55413783-55413805 CTACAGGAAGGAGGGGAAAGCGG - Intronic
1042955619 8:74247018-74247040 ACATAGCATTAAGGGGAAAAAGG + Intronic
1043276096 8:78395004-78395026 GCACAGGATTGAGGAGAAAGAGG - Intergenic
1043278805 8:78436954-78436976 CCATAGGTTTTTGGGGAAACAGG - Intergenic
1045931829 8:107635973-107635995 ACTGAGGATTGAGGAGAAAGGGG + Intergenic
1047056628 8:121171963-121171985 TGATAGGAGAGAGGGGAAAGCGG - Intergenic
1048453062 8:134551109-134551131 GCATAGCAGTGAGGGGAAAAAGG + Intronic
1048725781 8:137382349-137382371 CAATAGGATTGAGGCCACAGAGG + Intergenic
1048848656 8:138623418-138623440 CAATAGGATTGAGGCTACAGGGG + Intronic
1049104136 8:140600843-140600865 CCGTAGGATTGACGGGGAGGTGG + Intronic
1049622484 8:143604913-143604935 GCTTAGGATTGGGAGGAAAGAGG + Exonic
1050635701 9:7609993-7610015 CATTGGGATTCAGGGGAAAGCGG + Intergenic
1050939757 9:11443660-11443682 GCATAGCCTTGAGGGGAATGTGG - Intergenic
1051322530 9:15923481-15923503 CCAGAGGATGGAGTGGATAGGGG + Intronic
1053463498 9:38288571-38288593 CCACAGGGTGCAGGGGAAAGGGG + Intergenic
1054920436 9:70537663-70537685 CCATTTCATTGAGGGAAAAGGGG - Intronic
1054961712 9:70977088-70977110 CCATATGTTGGTGGGGAAAGGGG + Intronic
1055092220 9:72374558-72374580 CCAGGGGATAGAGGGGAAAGAGG + Intergenic
1059288359 9:113197922-113197944 CCATAGGATTCTGGGAAAAGTGG + Intronic
1059458201 9:114412934-114412956 CCATTGTAATGAGGGGAAGGAGG - Intronic
1061642468 9:131969981-131970003 GCATAGGAGGGAGGTGAAAGAGG + Intronic
1203703627 Un_KI270742v1:16021-16043 GCATAGGAGTGAGGGGGAGGAGG - Intergenic
1185524038 X:763337-763359 CCAGATGATGGAGGGGAATGAGG + Intergenic
1185590365 X:1272395-1272417 TTATAGGGTTGGGGGGAAAGAGG + Intronic
1185939204 X:4295779-4295801 AAATAGCATTGAGGAGAAAGAGG - Intergenic
1186587333 X:10889291-10889313 CCATAGGTTTTTGGGGAAACAGG + Intergenic
1187323945 X:18269008-18269030 TCATAGTAGTGAGTGGAAAGAGG - Intronic
1192995282 X:76506321-76506343 CCATTGGACTGGGGAGAAAGAGG - Intergenic
1195776382 X:108410647-108410669 CCATAACATTGGTGGGAAAGGGG - Intronic
1196376978 X:115044039-115044061 CTAGAGGATTCAGGGGAAACAGG - Intergenic
1196581788 X:117388563-117388585 GCATGGGGTTGAGGGGAAAGAGG - Intergenic
1196854666 X:119971501-119971523 CCATAGGATTCAGGGCCCAGGGG + Intergenic
1196870420 X:120108346-120108368 TCATAGGATTTATGGGAAGGTGG - Intergenic
1198621755 X:138520052-138520074 ACCTAGGATTGAGAGGAACGGGG - Intergenic
1199997889 X:153038016-153038038 CCATAGGGTGGAGGCCAAAGTGG + Intergenic