ID: 1102833796

View in Genome Browser
Species Human (GRCh38)
Location 12:116034104-116034126
Sequence AGTCTATTCTGGGGCTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102833796 Original CRISPR AGTCTATTCTGGGGCTTTAA AGG (reversed) Intronic
901105522 1:6752695-6752717 AGTCTATTCTTTGGGTTTGAAGG + Intergenic
902582488 1:17417083-17417105 TGTCTATTCTTGGTCTTTTAGGG - Intronic
903192477 1:21664417-21664439 AGTCTATTAAGGGCCTTGAATGG - Intronic
908397162 1:63736257-63736279 TGGCTATTCTGGGTCTTTCATGG + Intergenic
909083468 1:71144354-71144376 TGTCTATTCTGGGTCTTTTGTGG + Intergenic
917306704 1:173633512-173633534 TGGCTATTCTGGGGCTTTTGTGG - Intronic
918412528 1:184274664-184274686 TGGCTATTCTGGGTCTTTTATGG - Intergenic
920580010 1:207097627-207097649 AGTTAATTAGGGGGCTTTAAGGG - Intronic
924898649 1:248371012-248371034 TGTCTATTCAGGGTCTTTTATGG + Intergenic
1062843027 10:686078-686100 ATTCTTTTTTGTGGCTTTAAAGG - Intronic
1063550045 10:7023460-7023482 TGTCTATTCAGGGTCTTTTATGG - Intergenic
1068481606 10:57596269-57596291 ATTCTCTTCTGGGAGTTTAATGG + Intergenic
1071283121 10:84120711-84120733 AGTCCATTCTTGGTCTTTAGTGG + Intergenic
1071558748 10:86628762-86628784 TGTCCTTTCTGGGGTTTTAATGG + Intergenic
1072402143 10:95114552-95114574 TGGCTATTCTGGGTCTTTTATGG + Intergenic
1077821533 11:5747407-5747429 AGTGTATTCTTGGGCAATAAGGG + Intronic
1077850458 11:6070911-6070933 AGTCTATACAGGAGCTTAAATGG + Intergenic
1078045796 11:7913236-7913258 AGTCTATACAGGAGCTTAAATGG + Intergenic
1086305764 11:85480771-85480793 AATCTATTCTGGAGCCTTTAAGG + Intronic
1089855021 11:121536196-121536218 AGTCTTTTCAGGGGCTTTTCAGG - Intronic
1090515317 11:127418970-127418992 TGGCTATTCTGGGTCTTTTATGG + Intergenic
1090881835 11:130839913-130839935 AGTATATTCTTGGGCTTTTCAGG + Intergenic
1092687455 12:11066937-11066959 ATTCTATTTTGGGGCTTTTTGGG + Intronic
1094313280 12:29110190-29110212 AGTATCTTCTGAGACTTTAATGG - Intergenic
1095187653 12:39220099-39220121 AATCTATTATGGGGATATAAGGG - Intergenic
1095228625 12:39706474-39706496 AGGCTATTCTTGGTCTTTTATGG - Intronic
1098728870 12:74006944-74006966 TGGCTATTCTGGGTCTTTTATGG - Intergenic
1099705974 12:86153373-86153395 TGTCTATTTTGGGGTTTTTAGGG - Intronic
1099763775 12:86955658-86955680 TGGCTATTCTGGGTCTTTTATGG + Intergenic
1101552428 12:105775173-105775195 AGTCTAATCTGGAGTTTTCAAGG - Intergenic
1102318414 12:111909571-111909593 TGGCTATTCTGGGTCTTTTATGG - Intergenic
1102833796 12:116034104-116034126 AGTCTATTCTGGGGCTTTAAAGG - Intronic
1108594967 13:51941768-51941790 AGGCCATCCTGGGGTTTTAAAGG + Intronic
1110949732 13:81470697-81470719 TGGCTATTCTGGGCCTTTTATGG - Intergenic
1111484820 13:88882623-88882645 AGGCTATTCTGGGTCTTTTGTGG + Intergenic
1111574327 13:90131909-90131931 TGGCTATTCTGGGTCTTTGAGGG + Intergenic
1112378395 13:98865406-98865428 AGTCTATTCGTGTGCTATAAAGG - Intronic
1112968638 13:105231252-105231274 AATCTATTCTAGGTCTTTAGGGG - Intergenic
1114966335 14:27965743-27965765 TGGCTATTCTGGGGCTTTTATGG + Intergenic
1116547831 14:46192514-46192536 TGTGTATTCTGGGCCTTTAGTGG + Intergenic
1116810113 14:49531501-49531523 TGGCTATTCTGGGTCTTTAGTGG - Intergenic
1117046405 14:51817319-51817341 AGTCCCTTCTGGGACTATAAAGG - Intergenic
1117458965 14:55925999-55926021 AGTCCACCCTGGGGCATTAATGG - Intergenic
1118936450 14:70293331-70293353 AGGCTACTCTGGGGTTTTTAAGG + Intergenic
1119013880 14:71028770-71028792 ATTATGTTATGGGGCTTTAAAGG + Exonic
1119052396 14:71382918-71382940 AGAATATTCTGGGAGTTTAAAGG + Intronic
1124415462 15:29470051-29470073 AATCTATTCTGCGGTTTTCAAGG - Intronic
1126294634 15:47125055-47125077 TGTCTATTCTGGGTCTTTCATGG + Intergenic
1126681028 15:51202364-51202386 AGTCTATTCTGGGGGTGCAGTGG + Intergenic
1127694001 15:61426212-61426234 CCTCTATTGTGGGGCTTTTAAGG - Intergenic
1127863925 15:63016389-63016411 ATGCTATTTTGGCGCTTTAATGG - Intergenic
1130882721 15:88069012-88069034 TGGCTATTATGGGGCTGTAATGG + Intronic
1131932723 15:97462818-97462840 AGTCAATGCTGCTGCTTTAAAGG + Intergenic
1132277708 15:100583293-100583315 AGCCTAGTCTTGGTCTTTAATGG + Intronic
1132278783 15:100594312-100594334 TGTTGATTCTGGGGCTTAAATGG - Intronic
1134406490 16:13963871-13963893 TGTCTATTCTGGGTCTTTTGTGG + Intergenic
1136515539 16:30766085-30766107 AGTGTATGCTGGGGATGTAAGGG + Intronic
1137882741 16:52069257-52069279 AGTCTATGGAGGGGCATTAAAGG - Intronic
1139004667 16:62555595-62555617 TGGCTATTCTGGGTCTTTCATGG + Intergenic
1151276856 17:73041379-73041401 TGGCTATTCTGGGGCTTTGTGGG - Intronic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1153357519 18:4154034-4154056 ATTCTTTTCTGTGGCTTTCATGG + Intronic
1153433720 18:5046750-5046772 TTTCTTTTCTGGGGCTTCAATGG - Intergenic
1154162107 18:11988454-11988476 AGTCTTGTGTGGGGCTTTATAGG + Intronic
1155197747 18:23490712-23490734 TGGCTATTCTGGGTCTTTTATGG - Intergenic
1157850423 18:51043708-51043730 ATGCTATGCTGGGGCCTTAACGG - Intronic
1158260110 18:55597283-55597305 AGTCTATTATGGGATTATAATGG + Intronic
1158889178 18:61857425-61857447 AGACTATTCTGAGGCCCTAAAGG - Intronic
1160387058 18:78503167-78503189 ACCCTCATCTGGGGCTTTAATGG - Intergenic
1161915301 19:7223914-7223936 AGTCTATTCTGGTGGCTTAGAGG - Intronic
1164408247 19:27973967-27973989 AGTCAATTCTGTTGGTTTAAAGG - Intergenic
927358646 2:22206135-22206157 TGTATATTTTGGGTCTTTAAAGG - Intergenic
928247299 2:29641749-29641771 AGTTATTTCTGTGGCTTTAAAGG + Intronic
930442417 2:51425675-51425697 TGGCTATTCTGGGTCTTTTATGG - Intergenic
930608392 2:53515723-53515745 AGTCTATCCTGGGCCTTTTCTGG + Intergenic
932648105 2:73526250-73526272 TGTCTATTCTGGGTCTTTTGTGG + Intronic
932648249 2:73528599-73528621 AGTCTATTCATGGTCTTTATAGG + Intronic
932889921 2:75585049-75585071 TGGCTATTCTGGGTCTTTCATGG - Intergenic
936510911 2:113145567-113145589 TGTCTATTCTGGGTCTTTTGTGG + Intergenic
937723704 2:125133856-125133878 ATTATATTCTAGGGTTTTAAAGG - Intergenic
938916326 2:135944724-135944746 AGGCTCTTCTGAGGCTTGAAGGG + Intronic
939030187 2:137064988-137065010 TGCCTATTCTGGGTCTTTTATGG + Intronic
939737284 2:145863562-145863584 ACTCTATTCTGATGCTTAAAAGG + Intergenic
940508392 2:154583983-154584005 TGTCTATACAGGGGCTTAAATGG + Intergenic
941023188 2:160431836-160431858 AGCCTATTCTGGGGATTAAGAGG - Intronic
945576043 2:211530517-211530539 TGGCTATTCTGGGTCTTTTATGG - Intronic
947523773 2:230866354-230866376 AGTCTTGCCTGGGGCATTAAGGG + Intronic
948389128 2:237599476-237599498 AGGCCTTTCTGGGGTTTTAATGG + Intronic
1170292639 20:14787857-14787879 AGTCTATTCTGTGGCATTCTTGG + Intronic
1177431171 21:20994443-20994465 AGACAATTCTGAGGCTTTCAAGG - Intergenic
1182589675 22:31369331-31369353 AGTTTTTTCTGGGGCTTCAGTGG - Intergenic
1182958315 22:34448103-34448125 AGTCTCATCTGGAGCTTTTAGGG - Intergenic
949235419 3:1803113-1803135 TGTCTATTCTGGGTCTTTCATGG + Intergenic
949571230 3:5295196-5295218 TGTCTATACTGGGTTTTTAAAGG - Intergenic
949828741 3:8191097-8191119 TGGCTATTCTGGGTCTTTCATGG + Intergenic
950377378 3:12582785-12582807 ACTTTTTTCTAGGGCTTTAAGGG + Exonic
951380153 3:21974089-21974111 TGTCTATTCTGGGACTTTTGTGG - Intronic
951392721 3:22127052-22127074 AGTCTATTGTGTGTCTTTACAGG + Intronic
951818212 3:26779521-26779543 TGGCTATTCTGGGTCTTTTATGG + Intergenic
953011939 3:39035115-39035137 TGGCTATTCTGGGCCTTTCATGG - Intergenic
953246948 3:41201518-41201540 AGTCTATTCTGTAGGATTAAAGG + Intronic
954643244 3:52114814-52114836 TGGCTATTGTGGGGCTTTACCGG - Intronic
954644300 3:52121539-52121561 AGTCTATCCTGGGGCTTCTGTGG - Intronic
958890068 3:99773330-99773352 AGGCTCTTCTGGGTTTTTAAGGG + Intronic
959518843 3:107302860-107302882 AGTCTTTTCTGGTGGTTTACTGG + Intergenic
959645878 3:108700043-108700065 TGACTATTCTGGGTCTTTTATGG + Intergenic
962305818 3:134284859-134284881 TGGCTATTCTGGGGCTTTCGTGG - Intergenic
962499298 3:135973607-135973629 TGTCTATTCTAGGTGTTTAAAGG + Intronic
962842912 3:139251907-139251929 AGCCTCTTCTGGGGCTCTGAGGG + Intronic
963372783 3:144422817-144422839 AAGCTATTCTTGGGCATTAAAGG - Intergenic
964003041 3:151799415-151799437 AGTCTCTTCTGGGGCTTTCCTGG + Intergenic
964267021 3:154910152-154910174 TGTCTATTCTGGGTCTTTTGTGG - Intergenic
964350469 3:155798292-155798314 TGGCTATTCTGGGTCTTTTATGG - Intronic
964404747 3:156337621-156337643 ACTCTATTCTGGAACCTTAAAGG + Intronic
964525878 3:157614910-157614932 AGTCTTTCCTGGAGCTTAAAAGG - Intronic
965191041 3:165530195-165530217 AGCCTATTGTGGGGCTTTGTAGG + Intergenic
965908662 3:173743144-173743166 AGTTTATTATGAGTCTTTAAGGG - Intronic
966637129 3:182148036-182148058 ACTCTCTTCTGGGGCTGTGAAGG + Intergenic
970011224 4:11461538-11461560 TGGCTATTCTGGGTCTTTGATGG - Intergenic
970967632 4:21947362-21947384 AGTCAAATGTGGGGCTTTACAGG + Intronic
972266043 4:37460940-37460962 ATTCTCTTCTGGGGTTTTTATGG + Intronic
973838929 4:54841339-54841361 AGTCAAATCTGGTGCTGTAAAGG - Intergenic
974329861 4:60464171-60464193 AGTCTATTCATGGGCTTTGTAGG - Intergenic
974780956 4:66551906-66551928 GGGCTATTTTGGGTCTTTAATGG - Intergenic
975369111 4:73563539-73563561 TGGCTATTCTGGGTCTTTTATGG + Intergenic
976161581 4:82206430-82206452 TGGCTATTCTGGGTCTTTAGTGG - Intergenic
978978500 4:114911720-114911742 AGACTATTTTGAGGTTTTAAAGG - Intronic
979811992 4:125047761-125047783 TGGCTATTCTGGGTCTTTGATGG - Intergenic
979923623 4:126531878-126531900 AGGCTATTGTGAGGATTTAATGG - Intergenic
983676442 4:170299814-170299836 TGCCTATTCTGGGTCTTTTATGG - Intergenic
986992279 5:13568447-13568469 AGTTTATTGTGAGGATTTAATGG - Intergenic
987575512 5:19723331-19723353 AGTTTATTCTGTGTCTTCAAGGG + Intronic
988619871 5:32812025-32812047 AATCAATACTTGGGCTTTAACGG - Intergenic
988965153 5:36409013-36409035 TGTCTATTCTGGATCTTTTATGG - Intergenic
993268827 5:85766273-85766295 AGTCTATTCTGTGTCTTTTGTGG + Intergenic
994660364 5:102646730-102646752 TGGCTATTCTGGGTCTTTTATGG - Intergenic
995297003 5:110534471-110534493 AGTCTATACAGGAGCTTAAATGG - Intronic
1001659840 5:173383232-173383254 AGTCTCTTCTGGGTCTGTCAGGG - Intergenic
1003428513 6:6016793-6016815 TGTCTATTCTGGGTCTTTTGTGG + Intergenic
1004299431 6:14443908-14443930 AATGTTTTCTAGGGCTTTAATGG + Intergenic
1004300798 6:14455397-14455419 AGTCAATTCTGAGGCTCCAAGGG - Intergenic
1005270234 6:24155967-24155989 ATTCTATTCTGGGTCTTTTCTGG - Intergenic
1006618381 6:35345003-35345025 AGTCTAGTCTCTGGCTTTCAAGG + Intronic
1008237418 6:49067022-49067044 TGGCTATTCTGGGTCTTTTATGG - Intergenic
1008698227 6:54067164-54067186 AGTCTCTTTTGGGGGATTAATGG + Intronic
1009371624 6:62911012-62911034 TGGCTATTCTGGGTCTTTCATGG - Intergenic
1010328343 6:74591609-74591631 TGGCTATTCTGGGTCTTTTATGG - Intergenic
1011570391 6:88728467-88728489 AGTCTATTCTTGCTCTTTAGTGG - Intronic
1013532892 6:111036243-111036265 ATTCTATTGTTGGGCATTAATGG + Intergenic
1013603991 6:111731288-111731310 AGTCCTTTCTGTGTCTTTAAAGG - Intronic
1021780694 7:24103036-24103058 AGTCTATGCATGGGCTTTCATGG + Intergenic
1024369076 7:48559355-48559377 AGCTGATTCTTGGGCTTTAAAGG - Intronic
1028228155 7:88274012-88274034 AGTCTATTTTGTGGATTCAAAGG + Intergenic
1028263467 7:88693152-88693174 AATTTATTCTGGGGATTAAAGGG + Intergenic
1028829232 7:95308922-95308944 AGTCTATTTTTCTGCTTTAATGG + Intronic
1030431025 7:109449051-109449073 TGTCTATTCTGGGTCTTTTGTGG + Intergenic
1030613110 7:111710272-111710294 TGGCTATTCTGGGTCTTTAGTGG - Intergenic
1033488765 7:141819425-141819447 TGTCTATTCTGGGTCTTTTGTGG + Intergenic
1033521005 7:142160284-142160306 TGACTATTCTGGTGCTCTAATGG + Intronic
1033819628 7:145118667-145118689 TGGCTATTCTGGGTCTTTACTGG + Intergenic
1034244222 7:149632410-149632432 ATTCCATCCTGCGGCTTTAATGG + Intergenic
1036599105 8:10242749-10242771 ATTCTATTATGTGGCTTTGAAGG - Intronic
1037000352 8:13709687-13709709 TGGCTATTCTGGGTCTTTTATGG + Intergenic
1037051234 8:14377076-14377098 GGTCTATGCTGGGGCTATATAGG - Intronic
1037333711 8:17770744-17770766 AGACTTTTCTGAGGCTTTACAGG + Intronic
1037779556 8:21858382-21858404 AGTCTATTCTGGAGCACTATGGG - Intergenic
1038660875 8:29495564-29495586 AGACTTTTCTGGAGCCTTAAGGG + Intergenic
1041882990 8:62773880-62773902 TGTCTATTCTGGGTCTTTTGTGG + Intronic
1042637877 8:70898389-70898411 TGGCTATTCTGGGTCTTTAGTGG + Intergenic
1043531648 8:81157751-81157773 AGCCAAATTTGGGGCTTTAATGG - Intergenic
1044338951 8:91024847-91024869 GTTCTATTCTGGAGCTTTGAGGG - Intronic
1044878508 8:96698022-96698044 TGGCTATTCTGGGCCTTTAGTGG - Intronic
1046022678 8:108684907-108684929 TGTCTATTCAGGGTCTTTTATGG + Intronic
1047871643 8:129089514-129089536 ATTCCATTCTGGGGGTTTCATGG + Intergenic
1048119174 8:131560729-131560751 TGGCTATTCTGGGGCTTTTGTGG - Intergenic
1048612808 8:136042098-136042120 AAGTTATTCTGGGGCTTTAAAGG - Intergenic
1049079549 8:140431047-140431069 AGTATATGTTGGGGCTTAAAGGG - Intronic
1049456033 8:142689511-142689533 AGGCTACTCTGGGGTTTTTAAGG - Intergenic
1051793815 9:20840131-20840153 TGGCTATTCTGGGTCTTTCATGG + Intronic
1055378197 9:75673935-75673957 TGGCTATTCTGGGTCTTTTATGG + Intergenic
1056522790 9:87415565-87415587 CGTCTATACTGGAGCTTAAATGG - Intergenic
1057181605 9:93033597-93033619 AGTCTATTCTGGGGGGTTGCAGG + Intronic
1058072134 9:100612088-100612110 AGTCATATCTGGGACTTTAAAGG + Intergenic
1060779878 9:126403585-126403607 AGCCTCTTTTGAGGCTTTAAAGG - Intronic
1186107634 X:6225291-6225313 AATCTATGCTGAGGATTTAATGG + Intronic
1186983342 X:14983156-14983178 TGGCTATTCTGGGTCTTTTATGG - Intergenic
1188265724 X:28071425-28071447 TGTCTATTCTGGGCCTTTTGTGG - Intergenic
1188845570 X:35067829-35067851 AGGCTATTCTGGGTCTTTTGTGG + Intergenic
1190530776 X:51373669-51373691 TGGCTATTCTGGGTCTTTTATGG - Intergenic
1190709163 X:53053996-53054018 ACTCTACTCTGGGCCTTTGATGG - Intronic
1192856313 X:75016491-75016513 AGTCAATATTGTGGCTTTAATGG - Intergenic
1192905411 X:75545808-75545830 TGTCTCTTCTGGGGTTTGAAAGG + Intergenic
1193532096 X:82668163-82668185 AGGCTACTCTGGGGTTTTTAAGG - Intergenic
1193553683 X:82929235-82929257 AGGGTATTCTTGGGCATTAAAGG + Intergenic
1193755008 X:85397973-85397995 AGGCTATCCTGGGTCTTTCATGG + Intergenic
1194157524 X:90410643-90410665 TGTCTATTCTGGGTCTTTTTTGG + Intergenic
1194514671 X:94837302-94837324 TGTCTATTCTGGGTCTTTTGTGG + Intergenic
1195542809 X:106082258-106082280 TGGCTATTCTGGGGCTTTTGTGG + Intergenic
1197351705 X:125389928-125389950 CGTCTATACAGGGGCTTAAATGG + Intergenic
1197567364 X:128103649-128103671 TGTCTATTCAGGGTCTTTGATGG + Intergenic
1198037290 X:132813773-132813795 AGTCAATTGTGAGGCTTTTACGG - Intronic
1200272783 X:154702030-154702052 TGGCTATTCTGGGTCTTTCATGG - Intronic
1200503856 Y:3987624-3987646 TGTCTATTCTGGGTCTTTTTTGG + Intergenic
1200769249 Y:7108408-7108430 AGTCCATTCTTGCTCTTTAATGG - Intergenic
1201503698 Y:14674204-14674226 ATTTTATTTTGTGGCTTTAAAGG - Intronic