ID: 1102836908

View in Genome Browser
Species Human (GRCh38)
Location 12:116072300-116072322
Sequence CTGGTTTTCTTGATGAACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102836902_1102836908 3 Left 1102836902 12:116072274-116072296 CCTTTAAAATGATCTGGTCCAAA 0: 1
1: 1
2: 3
3: 30
4: 279
Right 1102836908 12:116072300-116072322 CTGGTTTTCTTGATGAACAATGG 0: 1
1: 0
2: 2
3: 19
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102836908 Original CRISPR CTGGTTTTCTTGATGAACAA TGG Intronic
900823499 1:4908342-4908364 CTGCTTTTCTTGATGTATGACGG + Intergenic
902100982 1:13988727-13988749 TTGTTTTTCTTTATTAACAAAGG - Intergenic
903071469 1:20728926-20728948 CTGGTTTTCATGATCTGCAAGGG - Intronic
903365004 1:22800910-22800932 CTGGTTTGCTTTAAGAACACTGG - Intronic
906912138 1:49965312-49965334 CTGGTCTTCTTCATTAAAAATGG + Intronic
907055484 1:51363343-51363365 TTGGTTTTCTTGAAGGAAAATGG - Intronic
907415097 1:54308804-54308826 CTGCTTTCCTTGGTGATCAATGG - Intronic
909201647 1:72696809-72696831 CTTGTTTTCTTATTGAACCATGG + Intergenic
909469228 1:76007965-76007987 CTGGTTCTCCTCATGAACATAGG - Intergenic
910916161 1:92291873-92291895 CTGGATTTCTTTATGAATAAGGG - Intronic
913519842 1:119634339-119634361 TTGGTGTTGTTGATGAAGAATGG + Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918569554 1:185972852-185972874 CTTGTTTTGTTGAATAACAAAGG + Intronic
919538552 1:198819686-198819708 CTGGTTTTGAAGATGAAGAAAGG - Intergenic
919794902 1:201315686-201315708 CTGGTTTTATGGCTGAAAAAAGG + Intronic
919836755 1:201580058-201580080 CTGGAGTTCTTGATGTCCAAGGG + Intergenic
921482733 1:215681498-215681520 CTTCTTTCCTTGATGAACAAGGG + Intronic
922129372 1:222761750-222761772 CTGGTCTTTTTGAAGAACCAGGG + Intergenic
923896261 1:238273339-238273361 CTAGTTTCCTTGATGAATATGGG + Intergenic
924032671 1:239902311-239902333 CTAGTTTTATAGATGAAGAAAGG + Intronic
924833439 1:247623314-247623336 CTAGTTTTCTTGATGGAAACTGG + Intergenic
1068429785 10:56916534-56916556 CTGGTTTGCTAAATTAACAAAGG + Intergenic
1069368805 10:67722120-67722142 CTGATTTTGTATATGAACAAGGG - Intergenic
1070930911 10:80259965-80259987 CTGGTTACCTTGATGAAGGAAGG - Intergenic
1071817018 10:89242544-89242566 CAGGTTTTTTTTATGAACACAGG - Intronic
1073483546 10:103802318-103802340 CTGGTCTTCTGGATGAGAAACGG + Intronic
1073541155 10:104316925-104316947 CTGGTTTCCTTACTGCACAAGGG + Intronic
1074263135 10:111874114-111874136 TTTATTTTCTTGATGAAGAAGGG + Intergenic
1076319200 10:129565782-129565804 CTGGTGATCTTGATGATCGAGGG + Intronic
1079437925 11:20476488-20476510 CTGGGTTTCTGGAGGAAAAATGG + Intronic
1080090552 11:28343103-28343125 ATGGTTTTCTTCATCATCAAAGG - Intergenic
1080555167 11:33409411-33409433 CTGGTTTTTATAAAGAACAAAGG + Intergenic
1081207777 11:40294362-40294384 CTGGATTTCTGGATGAAAACAGG - Intronic
1083053961 11:59801930-59801952 CTTGTTTTCTGGATGAATACTGG + Exonic
1083064265 11:59907750-59907772 CTGATATCCTTGATGAACATAGG - Intergenic
1084049629 11:66591405-66591427 CTGTTTTTCTTGACGTAGAAAGG + Exonic
1085440236 11:76555083-76555105 GTGTTTGTCTTTATGAACAATGG + Intergenic
1090432983 11:126662290-126662312 CTGGTTTCTTTGATGGTCAATGG - Intronic
1090648382 11:128784832-128784854 CTGGTGCTCTTGATGAACTCTGG - Intronic
1091584571 12:1808826-1808848 CTGGTTTTCTCCCAGAACAACGG + Intronic
1093100488 12:15022650-15022672 CAGGTTTTCTTTATCATCAACGG + Intergenic
1094202336 12:27806775-27806797 AGTGTTTTCTTGAGGAACAACGG + Intergenic
1094659260 12:32450669-32450691 CAGGCTTTCTTGGTGAACAAAGG + Intronic
1095136808 12:38614983-38615005 CTGGTTTTGATGATGGAAAAGGG - Intergenic
1095258308 12:40067907-40067929 CTTTTTTTCTTGTTGAAGAAAGG + Intronic
1098527408 12:71501610-71501632 CTGTTTTTATTGATCCACAAAGG + Intronic
1099164203 12:79282010-79282032 CTGGTTTTGTAGATAAAGAAAGG - Intronic
1099363746 12:81742065-81742087 CTGGTGTTCTTGCTGTCCAACGG - Intronic
1102836908 12:116072300-116072322 CTGGTTTTCTTGATGAACAATGG + Intronic
1102872253 12:116423143-116423165 CTGGTCTTCCTGATGACCAGAGG - Intergenic
1103847004 12:123908630-123908652 CTGGTTCTCCAGAGGAACAAGGG + Intronic
1105870531 13:24501856-24501878 TTGTTTTTCTTGATGCATAATGG - Intronic
1106671920 13:31915202-31915224 CTGGGCTTCTGGATGAACACTGG + Intergenic
1106780326 13:33052685-33052707 CTGTTTGGCTTAATGAACAAAGG + Intronic
1107665568 13:42686440-42686462 CTAGTTATCTTGGTGAATAATGG + Intergenic
1108085878 13:46792876-46792898 CTGGTTTCCTTGTGGAATAATGG - Intronic
1110499696 13:76212868-76212890 CTGTTTTTGTGGATGAAGAATGG - Intergenic
1112228650 13:97566058-97566080 TTCGTTTTCTTGCTAAACAAAGG + Intergenic
1113441725 13:110334288-110334310 CTGCTGTGCTTGATAAACAAAGG - Intronic
1114540483 14:23453552-23453574 CAGGTTCTCATGATGAAGAATGG + Intergenic
1114841176 14:26263680-26263702 CTAATTTTCTTCATGAGCAATGG + Intergenic
1116202851 14:41821556-41821578 CTGGTATCCCTGATGAACACAGG - Intronic
1116445904 14:45011110-45011132 TTGGCTTTCTTAATGAAAAAAGG + Intronic
1116541309 14:46105178-46105200 CTGTTTTTCTTCATTAACACTGG - Intergenic
1117240844 14:53830721-53830743 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1117251482 14:53943805-53943827 CTGGTTTTCTTGGTAATGAAGGG - Intergenic
1117678947 14:58183711-58183733 CTGGTCTTCTTTATAAACAAGGG + Intronic
1117900925 14:60532224-60532246 CTGGTTTTCATAATGTACAATGG + Intergenic
1118278170 14:64404662-64404684 TTGACATTCTTGATGAACAAGGG - Intronic
1123119518 14:105910246-105910268 CTGCATTTCTGGAAGAACAAGGG - Intergenic
1123685449 15:22793851-22793873 CTGGCTTTGTTGAGGATCAATGG + Intronic
1125735324 15:41921091-41921113 CTTGTTTTCTTTATGAAAAATGG - Intronic
1127401621 15:58592574-58592596 CTGGTTCCCTTGAAGAAAAATGG + Exonic
1128583460 15:68825768-68825790 CTGGTTTTCTTCCTGATGAATGG - Intronic
1128618869 15:69132148-69132170 CTGTTTTTCATGAAGAAGAAGGG - Intergenic
1130953162 15:88608051-88608073 CTTATTTTCTTTATGGACAAAGG + Intergenic
1131221446 15:90587944-90587966 CCCATTTTCTTGAAGAACAAGGG - Intronic
1132949081 16:2550443-2550465 CTGGTTTTCATGTTGATCAGTGG + Intronic
1132965507 16:2651685-2651707 CTGGTTTTCATGTTGATCAGTGG - Intergenic
1141316177 16:82964511-82964533 CAGGTTTTCTTTATTAATAAAGG + Intronic
1143349129 17:6274256-6274278 CTGGTTTTCTTGGTGCCCAAAGG - Intergenic
1143864664 17:9915354-9915376 CTTGGTTTCTTTATGAAAAATGG - Exonic
1147711755 17:42472004-42472026 CAAGTTTTCTTGTTGAGCAAAGG - Intronic
1148525705 17:48331111-48331133 TTCGTTTCCTTGATGAACAAGGG + Intronic
1149382385 17:56107087-56107109 CTGGATTTCTGGATGAACTTTGG + Intergenic
1149671418 17:58415969-58415991 CTTGTTTTGTTCATGAACATTGG - Exonic
1149923438 17:60679601-60679623 TAGGTTTTCTTTATGAACAGTGG + Intronic
1151479914 17:74363991-74364013 CGGGTCTTCTTGATGATCCAGGG - Intergenic
1152065337 17:78109489-78109511 CTGGTTTTCATGATGACCTGGGG - Intergenic
1153445720 18:5170677-5170699 CTCTGTTTCTTGATGAAGAATGG - Intronic
1156671038 18:39470070-39470092 CTGGATTACTTGATTTACAAAGG + Intergenic
1158063586 18:53377871-53377893 CTGAATCTTTTGATGAACAATGG - Intronic
1158369850 18:56788073-56788095 ATGGTTTTCTAGATGACTAAGGG + Intronic
1160058968 18:75512210-75512232 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1160312977 18:77813569-77813591 ATGGTTTTATTTGTGAACAATGG - Intergenic
1160397940 18:78585504-78585526 CTGGTTTTCATGATAAAGAAAGG + Intergenic
1160973866 19:1782887-1782909 TTGGTTTTCTGGATGAAGAGCGG + Exonic
1163558648 19:18006451-18006473 CTGGTTTTTTTGGTGGAGAAGGG - Intronic
1164089587 19:21936326-21936348 CTGGTTTTCTATATGAGCATGGG - Intronic
926950143 2:18233664-18233686 CTTATTTCCTTGATGAACAGTGG + Intronic
928844027 2:35646825-35646847 CATGTTTACTTGAAGAACAAGGG + Intergenic
929570373 2:43019072-43019094 CTGATTGTGTTGAAGAACAATGG - Intergenic
930354584 2:50301557-50301579 CTGATTTTCTTCTTCAACAAGGG + Intronic
930396965 2:50834273-50834295 TTTGTTTTCTAGGTGAACAAGGG + Intronic
931050285 2:58406506-58406528 CTGTTTTTCTTTTTGAACCAGGG + Intergenic
931487971 2:62712632-62712654 GTGGTTTTAGTGATGAACCATGG + Intronic
933430225 2:82167723-82167745 CTAGTTTTCTCTATGAAAAATGG - Intergenic
935359966 2:102238656-102238678 CTGGTTTCCTTGAAGAACAGAGG + Intronic
938291500 2:130153161-130153183 CTGGCTTTCTAGATCATCAATGG - Exonic
938772854 2:134515166-134515188 CTGGTTTTCAGGATGGACTAAGG - Intronic
938841840 2:135172065-135172087 TTTGTTTTCTTGATTAAGAAGGG + Intronic
939615132 2:144354134-144354156 CTTGTTTTCTTGATATAAAATGG - Intergenic
941614842 2:167707559-167707581 CTGGTTTTCAAGATGGAGAAAGG - Intergenic
942655023 2:178206479-178206501 TTGGTTTTCAAGATGAAGAAAGG + Intronic
942931664 2:181501310-181501332 CTGGTTATTTTAAAGAACAATGG + Intronic
943688990 2:190849790-190849812 CTGCCTGTCTTGATGACCAAGGG + Intergenic
943925707 2:193776315-193776337 CTGGTTTTTTTTATCATCAAGGG + Intergenic
944053399 2:195497050-195497072 CTGTTTTTGTTGATTTACAAGGG + Intergenic
944649524 2:201815474-201815496 CTGCTTTTCTTAATTAGCAAAGG - Intronic
945499844 2:210558169-210558191 CTGGTTTTCTTAATTTAAAATGG - Intronic
948969373 2:241413088-241413110 GAGGATTTCTTGAAGAACAAAGG - Intronic
1169972255 20:11280568-11280590 CTGTTTTTCTTTAGGAACATTGG + Intergenic
1170594449 20:17794556-17794578 ATTGTTTTCTTCATGAAAAAAGG + Intergenic
1170791338 20:19511912-19511934 TTGTTTTTCTTGAAGAACAGTGG + Intronic
1173142132 20:40493787-40493809 CTGCTTTTCTTGATGCCCCAAGG - Intergenic
1174854089 20:54026467-54026489 CTGGTTTACTTGATTAAGATGGG + Intronic
1175014005 20:55768688-55768710 CTGGTTTTCTGGATGTTGAATGG + Intergenic
1175049177 20:56137374-56137396 CAGGTGTTCTGGATGAACCAGGG - Intergenic
1175847630 20:62066603-62066625 CTGGGTTTATTGATTAAAAATGG - Intergenic
1178479462 21:32967135-32967157 ATGGGTTTCTTGCTGAACACAGG + Intergenic
1179306209 21:40155829-40155851 CTGGATGTCTTGATGAGAAAAGG + Intronic
1179444835 21:41423991-41424013 CTGATTTTGTTCGTGAACAAGGG + Intronic
1180390501 22:12277572-12277594 CTGGCCTTCTTGCTGAACCAGGG + Intergenic
1180409242 22:12587185-12587207 CTGGCCTTCTTGTTGAACCAGGG - Intergenic
1180410641 22:12603342-12603364 CTGGTCTCCGTGATAAACAAAGG + Intergenic
949843301 3:8343546-8343568 CTGGTGTTCTGGAAGAAAAATGG + Intergenic
949878020 3:8639327-8639349 CTGGTTATCGTGAAGCACAAAGG - Intronic
951469706 3:23043221-23043243 CTAGTTTTCTTGGTTAATAAAGG - Intergenic
954764478 3:52901595-52901617 CTGGTTTAATTGATCAACAGTGG - Intergenic
957120411 3:76083433-76083455 CTAGTTCTCATGATGAACAGTGG - Intronic
957693404 3:83600668-83600690 CTGGCTTTCTGGAAGAACAAAGG + Intergenic
958139990 3:89550152-89550174 TTGGTTTTCTTTATGAAGAGTGG + Intergenic
960028467 3:113034183-113034205 ATGGTGTTCTGGATGAGCAATGG + Intergenic
962320888 3:134389394-134389416 CTGATTTCCATGAGGAACAATGG + Intergenic
962957845 3:140282677-140282699 TTGGTTTTCTTGGTGTACACAGG - Intronic
965154167 3:165025377-165025399 CTGGTGTTCCTGAGGAAGAAGGG + Intronic
966308566 3:178566572-178566594 CTGGTTTTCTTGAAGGAGACAGG - Intronic
967604679 3:191431501-191431523 CTGGTTTTCTTCCTTTACAATGG - Intergenic
969070143 4:4529731-4529753 CTCGGTTTCTTCATGAATAAAGG + Intronic
969459325 4:7320353-7320375 GTGGTTTTAATGATGGACAATGG + Intronic
970141705 4:12989967-12989989 GAGGTTTTTATGATGAACAATGG - Intergenic
970856064 4:20650663-20650685 CTGCTTGACTGGATGAACAATGG - Intergenic
970949977 4:21743325-21743347 CTGGTTTTGAGGATGAACAGGGG - Intronic
971020584 4:22531150-22531172 ATAGTGTTCTTGATAAACAAAGG - Intergenic
971615879 4:28790008-28790030 CTGGTTTTCTTTGTGACAAAAGG + Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
973289951 4:48461210-48461232 CTGGCTCTCTAGATGAACAAAGG + Intergenic
973678098 4:53286563-53286585 CTGGTTTCCTTTATTAACTAGGG - Intronic
975189305 4:71441057-71441079 CTGGTTTTACAGATGAAAAAAGG + Intronic
975211442 4:71704997-71705019 CTGGTATTCCTGGTGAACAGAGG + Intergenic
975665365 4:76729625-76729647 CTGACTTTCTAGATGAGCAAAGG + Intronic
976962973 4:91002365-91002387 CTGGTATTCCTGAGGAAGAAGGG - Intronic
980190654 4:129520251-129520273 ATGGTTTTATTGGTGAAGAAGGG + Intergenic
980704646 4:136477749-136477771 CTGGCTTTCTTGATATAAAATGG + Intergenic
981164907 4:141546192-141546214 CTGGTTTTCTTGAGAGACAAGGG + Intergenic
981692253 4:147522729-147522751 TTGGCTTTCTTCATCAACAATGG - Intronic
982485718 4:155963244-155963266 CTGAATTTCATGAAGAACAAAGG - Intergenic
984648641 4:182245817-182245839 CTGGTTTTATTGCTCATCAACGG - Intronic
985483047 5:129643-129665 TTGGCTTTCTTCATCAACAAGGG + Intergenic
986992193 5:13567523-13567545 CTGCTATTCTTGCTAAACAATGG + Intergenic
987903579 5:24047386-24047408 TTGGTTTTCTTGAGCAACAAAGG - Intronic
988451992 5:31352550-31352572 CAGGCTTTGATGATGAACAACGG + Intergenic
990521210 5:56583280-56583302 TTGTTTTTCCTGATGAACAGTGG - Intronic
990614807 5:57496835-57496857 CTGGTTTTCTTGGAGCACATGGG - Intergenic
993375124 5:87141644-87141666 CACATTTTCTTGATGAACACTGG + Intergenic
995067998 5:107883887-107883909 ATGGTTTTCCAGATAAACAAAGG + Intronic
997154324 5:131536921-131536943 ATGGTCATCTTTATGAACAAGGG - Intronic
1000097415 5:157984166-157984188 CTGGTTTTCTTTAACAACGAAGG - Intergenic
1000598374 5:163242736-163242758 ATGGTTGTCATGATGTACAATGG - Intergenic
1001889101 5:175324273-175324295 CTGGTGTTCTTGGTTTACAACGG + Intergenic
1003792010 6:9556459-9556481 CTGGGTATCTTCATTAACAAAGG + Intergenic
1004667593 6:17762628-17762650 CTGGCCTTCTTGACGAACAAGGG + Intronic
1005659430 6:27980462-27980484 CTGGTTTTAATGTTTAACAATGG - Intergenic
1008058308 6:46968257-46968279 CTTGTTCTCTTAATGAACCAGGG + Intergenic
1008477812 6:51951186-51951208 ATGGTTTTCTAGATGTAGAAAGG - Intronic
1009815265 6:68725180-68725202 CTGGTTTGTTGGAGGAACAATGG + Intronic
1010027371 6:71235068-71235090 CTGGGGTTTTTGATGAACAGAGG + Intergenic
1010912273 6:81573511-81573533 CTAGTTTTCTACATGAACCATGG + Intronic
1011015473 6:82749498-82749520 TTGGTTTACTTAATGAATAAAGG + Intergenic
1011044452 6:83066200-83066222 CTTGGTCTCTTTATGAACAAGGG + Intergenic
1011425088 6:87219466-87219488 CTGCTTTTCTTGTTGATCAGTGG + Intronic
1011497593 6:87951709-87951731 CTGGGTTTCGTGCTGAAGAACGG + Intergenic
1011651706 6:89512325-89512347 TTGGGTCTCCTGATGAACAAAGG + Intronic
1012506506 6:99952458-99952480 TTAGTTCTATTGATGAACAATGG + Intronic
1014171624 6:118285237-118285259 CTGGTTTTCTTTATGACGACTGG - Exonic
1014910417 6:127085933-127085955 CTTTTTTTCTTTCTGAACAATGG - Intergenic
1015608256 6:134984157-134984179 CTTGTATTCTTGATAAACAATGG + Intronic
1016115235 6:140273759-140273781 TTGGTTTTCTTTCTAAACAAAGG - Intergenic
1018173156 6:161157588-161157610 CAGGTGTTTTTGATGATCAAAGG + Intronic
1018609799 6:165637067-165637089 TTGGACTGCTTGATGAACAAGGG + Intronic
1020987191 7:15150729-15150751 CTGTTTTCCCTGATGAACATAGG - Intergenic
1021776301 7:24058614-24058636 CTGGTTTTGTTTATGTTCAAGGG - Intergenic
1022341773 7:29475221-29475243 CTTCTTTTTTTGATGAATAAAGG - Intronic
1024367163 7:48534619-48534641 TTGGTTTTCCTGAGGAAGAAGGG - Intronic
1026774887 7:73225267-73225289 CTGGATTCCTTGATTAACAGAGG - Intergenic
1027072287 7:75167299-75167321 CTGGATTCCTTGATTAACAGAGG + Intergenic
1027983804 7:85259379-85259401 TTGGTTGTGTTGAAGAACAAAGG + Intergenic
1028683904 7:93571028-93571050 CTGGTTTTCTAAATGTATAAGGG + Intronic
1029941372 7:104484135-104484157 GGGGTTTTCTTAATGAAGAAAGG - Intronic
1030942784 7:115675898-115675920 ACTGTTTTCTTGATGAACTAGGG - Intergenic
1030969657 7:116039964-116039986 CTGTCTTACTTGAGGAACAAGGG - Intronic
1032137918 7:129298300-129298322 CTGGTTTTATTGTTGAACAAGGG + Intronic
1034777719 7:153846428-153846450 ATGGTGTTTTTGATGGACAAAGG + Intergenic
1035486207 7:159228118-159228140 TTGGTTTTTGTGATAAACAAGGG + Intergenic
1038428420 8:27480571-27480593 ATGGTTTTATTGAGGAACAACGG + Intergenic
1039176236 8:34809937-34809959 TTGGTTTTCATGAAGAACCATGG + Intergenic
1039225580 8:35384791-35384813 CTGGTCTTCTTTATGACTAAAGG + Intronic
1040379284 8:46856645-46856667 CTTGTCTTGTTGCTGAACAACGG + Intergenic
1041197303 8:55412832-55412854 CTGCCATTCCTGATGAACAATGG + Intronic
1042380185 8:68104400-68104422 CTGGTTTTCTTGATGTTCCTTGG + Intronic
1043541787 8:81271650-81271672 ATGGTTTTCTTGAGGAACAAGGG + Intergenic
1043946104 8:86254517-86254539 TTGGTTTTCTAGATGGAAAAGGG - Intronic
1044811168 8:96063699-96063721 CTGGTCTTCTTGATGAAGTGAGG - Intergenic
1046369278 8:113280093-113280115 CTGATATCCTTGATGAACATGGG - Intronic
1048226482 8:132592028-132592050 CTGGTGTATTTGATGAACTAAGG + Intronic
1048572299 8:135666168-135666190 CTGGTTTCCATTATGAACACCGG - Intergenic
1051482057 9:17571963-17571985 CTGGGTGTGTTAATGAACAAAGG - Intergenic
1051532691 9:18122582-18122604 GTGGTTTTTTTGAAGAACATTGG + Intergenic
1052176617 9:25471118-25471140 CTGGTTTTCTAGATTAAAACAGG - Intergenic
1055126979 9:72730304-72730326 CTGGTTTTGGGGAAGAACAAGGG + Intronic
1055271120 9:74559805-74559827 CTTGTTTTTTTCATAAACAAGGG - Intronic
1056650682 9:88458625-88458647 TTGGTTTTCTTGAAAATCAAGGG + Intronic
1059506541 9:114804381-114804403 CTGGTCTTCTAGATAGACAAAGG + Intronic
1060879328 9:127106996-127107018 CAGGTGTTCTGGATGAACAAGGG + Intronic
1061658853 9:132114405-132114427 CGGGTTTTCTAGATGAACATCGG + Intergenic
1203449435 Un_GL000219v1:98675-98697 CTGGTCTCCGTGATAAACAAAGG - Intergenic
1186058280 X:5674763-5674785 CTGTTTTTCTTAATGATAAATGG + Intergenic
1188593281 X:31865136-31865158 CTGCTTCTCTTTATGAACACTGG - Intronic
1191911017 X:66149909-66149931 GTGGTATTTTTGATCAACAAGGG - Intergenic
1192070643 X:67936838-67936860 CTTGTCTTTTTGATGAAAAAGGG + Intergenic
1192237910 X:69307565-69307587 CTGCTTTTCTCCATGAACACTGG - Intergenic
1192375670 X:70558817-70558839 CTAATTTTCCTGATGACCAATGG - Intronic
1193258088 X:79373835-79373857 CTTGCTTTCCTGATGAAAAATGG + Intergenic
1195837350 X:109131939-109131961 CTGGTTAGATAGATGAACAAAGG + Intergenic