ID: 1102843441

View in Genome Browser
Species Human (GRCh38)
Location 12:116151425-116151447
Sequence CTGTCCTAACACCTTGCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102843441 Original CRISPR CTGTCCTAACACCTTGCTAA TGG (reversed) Intronic
901343623 1:8518309-8518331 CTGTCCCAGCACCTTGGGAATGG - Intronic
902536486 1:17121835-17121857 CCGTCCTTACACCGTGCTGAGGG - Intergenic
903170925 1:21552798-21552820 CTGTCACAACACTTTTCTAACGG + Intronic
904198011 1:28800528-28800550 CTGTCCTGACCCCTTGGGAAGGG + Intergenic
904310058 1:29623233-29623255 CAGTGCTAGCTCCTTGCTAATGG - Intergenic
909676177 1:78241462-78241484 CTGTCCTCACTCCTTCCAAAGGG + Intergenic
910593162 1:88949975-88949997 CTGTCCTAATCACTTCCTAAAGG - Intronic
918422862 1:184381748-184381770 CAGTGCTAACAACTTGCTAATGG - Intergenic
1063613007 10:7579223-7579245 CTGTCTTAAAATCTTGCTTAGGG + Intronic
1067220043 10:44337362-44337384 CTGTCCTCCCACCTTGGTAGGGG + Intergenic
1067980548 10:51079479-51079501 CTGTGCTGTCACTTTGCTAATGG - Intronic
1070812241 10:79304261-79304283 CTGTCCTAACACTGTCCTGAAGG + Intronic
1072425763 10:95329178-95329200 TTCTCCTAACACCTTTATAAGGG + Intronic
1076445294 10:130510057-130510079 GTTTCCTAACATCTTGCAAAGGG - Intergenic
1077825702 11:5806298-5806320 CTGACCTCACACCTTGCTCATGG - Intronic
1079557739 11:21781929-21781951 GTGTCTTAACACCTTGCAACGGG - Intergenic
1081443776 11:43109608-43109630 GTGTCCCAACACCTTCCTGAGGG + Intergenic
1084082617 11:66838613-66838635 CTGTCCTAACATCTTGGGGAGGG - Intronic
1087054811 11:93923148-93923170 CGATACTACCACCTTGCTAATGG + Intergenic
1091097427 11:132837490-132837512 CTGTCCTAAAACCTAGCTATAGG + Intronic
1102843441 12:116151425-116151447 CTGTCCTAACACCTTGCTAATGG - Intronic
1103280708 12:119755968-119755990 CTGTCATTACATCTTGATAAAGG + Intronic
1103697948 12:122832223-122832245 CTCTCCTAACACATCTCTAAGGG - Intergenic
1108083247 13:46759167-46759189 CTCTCCTAACAACTTGCTATAGG + Intergenic
1111041701 13:82757358-82757380 CTGTGCAAAGACCTTGGTAAGGG + Intergenic
1126303915 15:47232457-47232479 CAGGCCTCACACCTTGCTGATGG - Intronic
1126833724 15:52637032-52637054 CTATCCAACCACCTTACTAAGGG + Intronic
1127617004 15:60696198-60696220 CTGTCCTATCAGCTCGCTAATGG + Intronic
1130893333 15:88151491-88151513 CAGTCCTATGACCTTCCTAATGG + Intronic
1131833314 15:96367966-96367988 CTGTAATAACACCTTGCAAGGGG + Intergenic
1133131277 16:3677428-3677450 CTTTCCAAACTCCATGCTAAGGG + Intronic
1135493264 16:22928873-22928895 CTGTCCTAACGTCTTGGGAATGG - Intergenic
1137434988 16:48447659-48447681 CTGTCCTCACAGCTTGCTGCTGG - Intronic
1141805982 16:86341784-86341806 GTGTCTTAATACCTTGCTGAGGG - Intergenic
1144140776 17:12345676-12345698 CTCTCCCCACACCTTGCTGAAGG + Intergenic
1146769602 17:35556446-35556468 CTTTCCTAACTCATTGCTGATGG + Intronic
1147592232 17:41691334-41691356 ATGTCCTATCACCTCGCTAGCGG - Exonic
1152086641 17:78223640-78223662 CTTTCCTAAGACATTGCTAAGGG - Exonic
1156335186 18:36165219-36165241 GTGGGCTAACACCTTGCTCAGGG - Intronic
1159139386 18:64373973-64373995 CTCTCCTAACGCCTTGCCCAAGG - Intergenic
1166655267 19:44606565-44606587 CTGTCCCAACCCCTAGCTCAGGG + Intergenic
926612853 2:14963685-14963707 TTGTCACAACTCCTTGCTAAGGG + Intergenic
929650529 2:43676319-43676341 CTGTCCTAACGCCTGGAAAATGG - Intronic
939616852 2:144371323-144371345 CAGTCTTAACTGCTTGCTAATGG + Intergenic
941595506 2:167471902-167471924 CTCTCCTACCACCTGGCCAAAGG - Intergenic
942511769 2:176709963-176709985 GGGTTCTAACACCTTCCTAATGG + Intergenic
942543580 2:177039494-177039516 CTTTCCCAGCACCTTGCTGAGGG - Intergenic
944613109 2:201431368-201431390 CTCTTCTAACACCTTGCTTTTGG - Intronic
945869873 2:215215489-215215511 CTGCCATCACTCCTTGCTAAGGG + Intergenic
1168916384 20:1491579-1491601 CTGTGCTAAAACCTTGCCATAGG + Intronic
1173890099 20:46500678-46500700 CCTTCCTAAGACCTTTCTAATGG - Exonic
1175546810 20:59783520-59783542 CTGTCTTATCACCTTGTCAAGGG - Intronic
1176118596 20:63444135-63444157 CTGTCCCTCCACCTTGCTCACGG - Intronic
1185159474 22:49214502-49214524 CTTTCCCAACACCTTGTTCAGGG - Intergenic
949498490 3:4655882-4655904 CAGTACTAACACCTTGCCACCGG - Intronic
954857777 3:53661147-53661169 AAGTCCTAACACCTTTCTGAGGG + Intronic
958553028 3:95641118-95641140 TTGTCTTAAAACCTTGCAAAGGG - Intergenic
958822110 3:98987518-98987540 CTGTCCTCAGACCTTGCTGTGGG - Intergenic
970145951 4:13035907-13035929 TTGTCCTAACACCTGGGAAAGGG + Intergenic
971909335 4:32775190-32775212 TTGTCCTATCACCTTGCTGTTGG - Intergenic
971923487 4:32974850-32974872 CTGTCCTATCACCTTGCCTGTGG + Intergenic
972919344 4:43919249-43919271 TTGTCCTAACATATTGCTACAGG + Intergenic
977681110 4:99799397-99799419 CTGACCAAACAGCTTGCTCAAGG + Intergenic
980644326 4:135622535-135622557 CAGTCCTAACACCTAGCAAGAGG - Intergenic
981049596 4:140297203-140297225 CTCTCCAAAGACCTTGCAAACGG - Intronic
985111204 4:186547402-186547424 CTGTCCTCACACCCTGTTCATGG + Intronic
985817078 5:2135126-2135148 CTGTCCAAACACCGGGGTAAAGG + Intergenic
989767134 5:45100847-45100869 CTGCTCAAACACCTTGCTGAAGG - Intergenic
993966857 5:94369561-94369583 CTTTCCTCAGACATTGCTAAAGG - Intronic
999404292 5:151293383-151293405 CTGCCCGAACACCTGGCTGAGGG - Exonic
1002836386 6:868658-868680 CTGCCCTGACACCTTCCAAAAGG + Intergenic
1007178998 6:39915148-39915170 CTGTCCTTACAGGCTGCTAAGGG - Intronic
1008844143 6:55940945-55940967 GTGTCCTAACATCTTCCTACAGG - Intergenic
1011211988 6:84965066-84965088 CTGACCCCACACCTTGCTCATGG - Intergenic
1015218896 6:130781734-130781756 CTGACCTGACAGCTTGCTATAGG - Intergenic
1031700453 7:124918570-124918592 ATTTCCTACCACCTTTCTAATGG - Intronic
1035252596 7:157606892-157606914 CTGTCCTGACACCTTCCTTCAGG + Intronic
1035895858 8:3400085-3400107 CTGTCACAAAACCTTGCAAAAGG - Intronic
1037054310 8:14419274-14419296 ATGTCCTAACAGCTAGATAATGG + Intronic
1042192057 8:66196954-66196976 CTCTCCTATCACCTTGACAATGG - Intergenic
1045546290 8:103131820-103131842 CTGTCCTAAAACCTTCCTCCCGG + Intergenic
1049952730 9:660844-660866 ATGTCCTATCACCTCGCTATTGG - Intronic
1051188182 9:14482320-14482342 CTGTCCTAAACCCATTCTAATGG + Intergenic
1057582690 9:96301729-96301751 CTGTCACCACACCTGGCTAATGG - Intronic
1057739810 9:97701321-97701343 CGGCCCTAACACCTTTCTCAAGG - Intergenic
1185912472 X:3997819-3997841 TTGTCCTAATCCCTTCCTAAGGG - Intergenic
1191181965 X:57573983-57574005 CTCTCCTAAAACCTTTCAAAGGG - Intergenic
1193347968 X:80426171-80426193 CTTTCCTAACACCTAGCTTTCGG - Intronic
1197263854 X:124345908-124345930 CTTTCCTAACACCTTGTCCAAGG - Intronic