ID: 1102843827

View in Genome Browser
Species Human (GRCh38)
Location 12:116155915-116155937
Sequence ATTAGAAATAGTAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 255}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102843823_1102843827 -6 Left 1102843823 12:116155898-116155920 CCAGTATGTATTTTCATATTAGA 0: 1
1: 0
2: 1
3: 24
4: 286
Right 1102843827 12:116155915-116155937 ATTAGAAATAGTAAGGTGGAGGG 0: 1
1: 0
2: 4
3: 18
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102843827 Original CRISPR ATTAGAAATAGTAAGGTGGA GGG Intronic
902403853 1:16172544-16172566 AGGAGAAACAGTAGGGTGGAGGG - Intergenic
903917571 1:26775280-26775302 ATCCAGAATAGTAAGGTGGAGGG - Intronic
907253664 1:53161274-53161296 AATGGAAATAGTCAGGTGGCTGG - Intergenic
909175890 1:72358006-72358028 ATTAGAAATTGTGAGGCTGAAGG + Intergenic
910772426 1:90843590-90843612 ATTAATAATAGGAAGGGGGAAGG + Intergenic
911352932 1:96777140-96777162 ATTAGAAATAATAAGCTTTATGG + Intronic
911475286 1:98366371-98366393 ATGAGCAATACTCAGGTGGAAGG - Intergenic
911535153 1:99090630-99090652 ATTAGAAACAGTAACAAGGAAGG + Intergenic
912404275 1:109423790-109423812 ATTAACAATAGTTAGGTGAAAGG - Intronic
912828423 1:112927638-112927660 ATTAAAAATAGAAAGGGGTACGG + Intronic
913074965 1:115334421-115334443 ATCAGAAAGAGTAAGGTGAAGGG - Intronic
914684458 1:149965924-149965946 TTCAGAAATAGGAAGGTGGAAGG - Intronic
914741543 1:150470083-150470105 ATTAGAGATAATAAGTTTGAAGG + Intronic
916355166 1:163897819-163897841 ATTAGAAATGGGAAGTTGGCTGG + Intergenic
918326464 1:183416042-183416064 TTTAGATATAGAAAGGTGAAAGG - Intronic
919610791 1:199743368-199743390 ATTAGAAAAAGAAATGTAGAAGG - Intergenic
919714974 1:200766763-200766785 ATGGGAAGTAGTAAGGTGGAAGG + Intronic
920121647 1:203663298-203663320 ATTAGAAAAAGAAAGGAAGAAGG - Intronic
920930936 1:210387286-210387308 ATTACTAATAGCAAGCTGGAGGG + Intronic
921035494 1:211374370-211374392 TTCAGAAATTGTAAGGTGCATGG - Exonic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921524773 1:216202997-216203019 ATTAGAAATACAAAGATGAAAGG - Intronic
924281421 1:242440968-242440990 ATTATAAATAGTAATTTGGAAGG + Intronic
1062964300 10:1595468-1595490 ATTAGAAAAAATAGTGTGGAGGG + Intronic
1063517084 10:6707011-6707033 ATTATAAAAAGTCAGGTGTAAGG + Intergenic
1064009461 10:11724137-11724159 ATTACAAATAGAAAGATGGCCGG + Intergenic
1065153219 10:22843532-22843554 ATTAGAAATAATTATTTGGAGGG - Intergenic
1066316026 10:34247151-34247173 ATTAGACATAGAAAGGAAGAGGG + Intronic
1066450502 10:35523847-35523869 ATTAGCACTAATAAGGAGGAAGG + Intronic
1066966888 10:42275808-42275830 ATTAAAAATAATATGGTAGAAGG + Intergenic
1067684225 10:48457444-48457466 ATTAGAAATTCTAAGGGGGGTGG - Intronic
1067984957 10:51133051-51133073 CTGAGACATAGTTAGGTGGATGG + Intronic
1068273382 10:54759076-54759098 CTGAGAAGTAGTAAGATGGAGGG - Intronic
1068945491 10:62724932-62724954 ATTAGAAATAATTACGTGGCAGG + Intergenic
1069303319 10:66936424-66936446 ATTAGAAATAGGAAAATAGAAGG - Intronic
1070707187 10:78648241-78648263 GTTAGGAACAGGAAGGTGGAAGG - Intergenic
1070872295 10:79767021-79767043 ATCAGAAAAAGTAAGGTGGATGG + Intergenic
1071038578 10:81278275-81278297 ATTAAAGATAGGAAGGGGGACGG + Intergenic
1071135094 10:82444548-82444570 ATAGAAAATACTAAGGTGGAGGG + Intronic
1071639215 10:87289192-87289214 ATCAGAAAAAGTAAGGTGGATGG + Intergenic
1071656022 10:87448757-87448779 ATCAGAAAAAGTAAGGTGGATGG - Intergenic
1072114271 10:92354719-92354741 ATTAGAAATGGTAAGAGTGATGG + Intergenic
1072166049 10:92814102-92814124 ATGAGAAGCAGTGAGGTGGAAGG - Intergenic
1072823273 10:98579771-98579793 TTTAGAAACTGTAAAGTGGAGGG - Intronic
1073383693 10:103103352-103103374 TTTAATAAAAGTAAGGTGGAAGG + Intronic
1073585857 10:104709192-104709214 GTTGGAAATAGTGAGGTAGAGGG + Intronic
1074126253 10:110530751-110530773 ATTAGAAATTGAAAGGTGCAAGG + Intergenic
1075269159 10:121034064-121034086 ATTAGTAATAGTAATGTGTCCGG + Intergenic
1076586243 10:131549706-131549728 AATAGAAATTGTCAGCTGGAGGG + Intergenic
1080741770 11:35071633-35071655 AATAGAAAAAGTGAGGTGGGAGG + Intergenic
1081086124 11:38803678-38803700 ATCAGAAATATGAAGGTGGGTGG + Intergenic
1081134201 11:39418008-39418030 AATAAAAATAGTAAGCTTGATGG - Intergenic
1082059254 11:47846605-47846627 ACTAGAAATAGAAAAGTAGATGG - Intronic
1083466163 11:62847768-62847790 ATTAGCAAGGGTAAGGTTGATGG - Intergenic
1086308992 11:85515053-85515075 ATTAAAAATAATTTGGTGGATGG + Intronic
1087417666 11:97878518-97878540 ATAATCAATGGTAAGGTGGAAGG + Intergenic
1087559228 11:99763347-99763369 ATCATAAATATTAATGTGGATGG + Intronic
1089003861 11:115074627-115074649 ATCAGAAATAGGTAGGAGGATGG + Intergenic
1090797570 11:130148056-130148078 ATTATAAATAGAAACTTGGAAGG + Intergenic
1091579749 12:1777070-1777092 AGAAGAAAGAGTAAGATGGAGGG + Intronic
1092250954 12:6896241-6896263 AAAAGAAATAATAAGGTGGCAGG + Intronic
1092739930 12:11618400-11618422 ATTAGGAATAATAAGGGTGAAGG + Intergenic
1093542871 12:20308595-20308617 ATGAGAACTAGGCAGGTGGAGGG - Intergenic
1095932885 12:47646831-47646853 TTTAGAAAGATGAAGGTGGAGGG - Intergenic
1097614062 12:61862674-61862696 ATTAGAAATAGCAAGGAGGATGG - Intronic
1099602421 12:84758103-84758125 CTTAGCAATAGTGATGTGGATGG + Intergenic
1099776900 12:87145581-87145603 ATTAAAAATTTTAAGGTGAATGG - Intergenic
1100879328 12:98998917-98998939 TTTAGCAATAGTAAAGTGTAGGG - Intronic
1101180051 12:102206502-102206524 TTTAGATATAGATAGGTGGAGGG - Intergenic
1101500179 12:105297019-105297041 ATTATGAATAGTATGGGGGAGGG + Intronic
1102843827 12:116155915-116155937 ATTAGAAATAGTAAGGTGGAGGG + Intronic
1102940877 12:116940462-116940484 ATAAAAAATAGTGTGGTGGAAGG + Intronic
1104508852 12:129357465-129357487 AGTAGAAAAAGGAAGGAGGAAGG + Intronic
1105046988 12:133012873-133012895 ATAAGAAATAGAAAGCTGGCCGG - Exonic
1107266368 13:38560880-38560902 TTAAGAAGTAATAAGGTGGAAGG + Intergenic
1108996264 13:56737840-56737862 ATTAGAAATATAATGGTGAATGG + Intergenic
1109788819 13:67220440-67220462 ATGTGAAATAGTAAAGTAGAGGG - Intronic
1110050991 13:70898778-70898800 ATTAATAATTGTAAGTTGGATGG - Intergenic
1111872454 13:93849882-93849904 ATTAGAATTATTAAGGAGAAAGG + Intronic
1114203832 14:20549233-20549255 ATAAGAAAAAGTAAAGTAGAGGG - Intergenic
1114479392 14:23022889-23022911 AGTAGAAAAAAAAAGGTGGATGG - Intronic
1117430274 14:55651687-55651709 ACTAAAAATAATAAGGGGGAGGG - Intronic
1117522999 14:56569502-56569524 ATTATAAATGGTAATGTAGAAGG - Intronic
1117791385 14:59345535-59345557 AGTTTAAATAGCAAGGTGGATGG + Intronic
1118215748 14:63807010-63807032 ATTAAAAAGAGAAATGTGGATGG - Intergenic
1119904858 14:78292478-78292500 ACTAGAAAGAGGGAGGTGGAAGG + Intronic
1121550998 14:94800391-94800413 TTTAGAAATTGTAGGGTGGGAGG - Intergenic
1123987201 15:25656464-25656486 AGTACACAGAGTAAGGTGGATGG + Intergenic
1125245083 15:37627100-37627122 ATTAGAAACAGGGAGGTCGATGG + Intergenic
1126573837 15:50179055-50179077 AGTAGAAAGAGGAAGGTGCAGGG + Intronic
1126892944 15:53225554-53225576 ATTTGGAATATAAAGGTGGAAGG - Intergenic
1127656467 15:61060678-61060700 ACTAGAAAGAGTGAGGTGGCTGG - Intronic
1128286423 15:66440802-66440824 ATTAGAATTAGAAAGTTGTATGG + Intronic
1129818880 15:78582502-78582524 AAAAGAAAAAGTAAGGTGGGTGG + Intronic
1130123109 15:81069354-81069376 ATTAGAAAGGCTAAGGTGGCTGG + Intronic
1130833519 15:87627178-87627200 ATTGGAAATAGGAAGGCGCATGG - Intergenic
1131540137 15:93268853-93268875 ATTAGAATTTTTAAGTTGGAAGG + Intergenic
1132478856 16:155904-155926 AATACAAATAATAAGGTGGGTGG + Intronic
1133571460 16:7044634-7044656 ATGAAAAAAAGTAAAGTGGAAGG - Intronic
1133657755 16:7882768-7882790 ATTAGAAATAAAAAGATAGAGGG - Intergenic
1137361223 16:47817623-47817645 ATTAAAAATAGTATTATGGAGGG + Intergenic
1137422759 16:48350087-48350109 TTTAAAAATAGTAAGGAGGCTGG + Intronic
1140975837 16:80059397-80059419 ATTAGAAATAGTTAGGACAAAGG - Intergenic
1141133865 16:81453221-81453243 GTCAGAAATGGTAGGGTGGACGG + Intronic
1141994985 16:87630609-87630631 ATTAAAAATTTTAAGGAGGAGGG - Intronic
1142018839 16:87767184-87767206 ATTTTAAATGGGAAGGTGGAAGG - Intergenic
1143617633 17:8063311-8063333 ATTACAAATACAAAGTTGGATGG + Intergenic
1144543537 17:16169984-16170006 TTTCAAAATAGTAAGTTGGATGG - Intronic
1145349366 17:22066966-22066988 TTTCAAAATAGTAAGTTGGATGG - Intergenic
1146167614 17:30601715-30601737 TTTAGAAAAAGGAAGGGGGAGGG - Intergenic
1146220022 17:31009637-31009659 TTTAGAAAAAGGAAGGGGGAGGG - Intergenic
1147230188 17:39012052-39012074 ATTGGAGATAGTAAGTTGGGGGG - Intergenic
1147533210 17:41299448-41299470 ATTAGAAACAAAAAGGAGGAGGG - Intergenic
1149115281 17:53086698-53086720 AATGGAAATAGTAAGCTGTATGG - Intergenic
1151431830 17:74068870-74068892 ATGAGAAATAGAAAAGTGAAAGG + Intergenic
1203164607 17_GL000205v2_random:82269-82291 ATTATTATTAATAAGGTGGAGGG + Intergenic
1154292198 18:13118469-13118491 AAAAGAAAGAGTAAGGTGGAAGG - Intronic
1155739204 18:29265865-29265887 ATTAGAGATAGAAAGGAGAATGG + Intergenic
1157095689 18:44683644-44683666 ATGAGAAATAGCTAGCTGGATGG + Intronic
1164487196 19:28668611-28668633 TTTAAATATAGTAGGGTGGATGG - Intergenic
1165790130 19:38486329-38486351 ATAATAAAAAGAAAGGTGGATGG - Intronic
1167022194 19:46885740-46885762 ACTAAAAATAAAAAGGTGGAGGG - Intergenic
1168010991 19:53532085-53532107 ATGATAACTAGTAAGGTGAAGGG - Intronic
926799440 2:16646733-16646755 AGTAGAAAGAGTAAAGTGGGTGG + Intronic
927037151 2:19189764-19189786 ATTGGGAATGGGAAGGTGGAAGG + Intergenic
928645545 2:33348363-33348385 ATTAAATATAGAAAGGTGAAGGG + Intronic
929368290 2:41188793-41188815 TTTAAAAATAGTAATGTGGCAGG + Intergenic
930188163 2:48430617-48430639 ATTATAAATACTGAGGAGGAAGG + Intergenic
930630551 2:53749267-53749289 ATTAGAATTACTAAGATGTAAGG + Intronic
930920246 2:56744483-56744505 TTAAGAAATAGCAAGGTGAAAGG + Intergenic
931683587 2:64773046-64773068 ATTAGAAATAGAAAGGTTTTGGG - Intergenic
932987928 2:76748923-76748945 ATGAGAAATAGAAAGATGGGTGG + Intronic
935927438 2:108085431-108085453 ATTGGAAATAGTAAATTGGAGGG - Intergenic
936551104 2:113440178-113440200 CTTAGAAATATTAAGGGGGCCGG - Intronic
941344188 2:164347623-164347645 ATTATCAACAGTAAGGAGGATGG - Intergenic
943554218 2:189382246-189382268 ATTAAAAATATTGAGGTGGAAGG + Intergenic
943771261 2:191720394-191720416 ATTAGAAATAATAATGTGGCTGG + Intergenic
944070897 2:195667563-195667585 ATTACAAAAAGTATGGTGGAGGG - Intronic
944213883 2:197234603-197234625 ATTAAAAAGAATGAGGTGGATGG - Intronic
944927229 2:204477722-204477744 TTTAGAAAGAGTAGGGAGGAAGG + Intergenic
946060225 2:216934902-216934924 CTTCCAAATAGTAAGGGGGATGG - Intergenic
946785424 2:223238669-223238691 ATTAAAAGTATTAAGGTGAAGGG - Intergenic
947400326 2:229725304-229725326 ATTTAAAATAGTAATTTGGATGG - Intergenic
1169044461 20:2524779-2524801 AATAAAAATAGTAAGAGGGAAGG - Intergenic
1169323760 20:4657906-4657928 ATTAGAATCAGTAAGCTGGTGGG + Intergenic
1169526399 20:6431011-6431033 ATGAGAAATATAAAGGTGTAAGG + Intergenic
1170709407 20:18776598-18776620 ATTATAAAAAGTAAAGTAGAGGG + Intergenic
1170709424 20:18776824-18776846 ATTATAAAAAGTAAAGTAGAGGG + Intergenic
1171559266 20:26107975-26107997 TTTTGGAATAGTAAGTTGGATGG - Intergenic
1173959119 20:47057675-47057697 GAAAGAAATTGTAAGGTGGAAGG + Intronic
1175059820 20:56231723-56231745 AATAGAAATAATAAGGGTGATGG + Intergenic
1176651680 21:9554104-9554126 TTTCAAAATAGTAAGTTGGATGG + Intergenic
1177576266 21:22960182-22960204 ATTAGACTTAGTAAGTGGGAAGG + Intergenic
1178259510 21:31085938-31085960 CTTAAAAATAGTAAAGGGGAAGG + Intergenic
1178282713 21:31297284-31297306 GGCAGAAATAGAAAGGTGGATGG + Intronic
1178564885 21:33674514-33674536 ATTAAAAATAATAATATGGAGGG + Intronic
1183133073 22:35858505-35858527 GTGAGAAATAGGAAGATGGATGG - Intronic
1184449356 22:44573831-44573853 ATCAGATAGGGTAAGGTGGAGGG - Intergenic
951870096 3:27352072-27352094 ATTGGGAAGAGTAAGGGGGAAGG + Intronic
952063494 3:29539496-29539518 ATTAGATGTAATAAGCTGGAGGG - Intronic
953097948 3:39797416-39797438 AATAAAAATAGAAATGTGGAGGG - Intergenic
954763828 3:52897011-52897033 ATTCGAGATGGTAAGGTGGGAGG + Intronic
954819893 3:53316855-53316877 AGTAGAAATGGAAAGCTGGAAGG - Intronic
955114733 3:55986429-55986451 ATTTGAACCAGTAAGTTGGATGG + Intronic
957080330 3:75631337-75631359 AGTAGAAATAGGGAGCTGGATGG - Intergenic
959951095 3:112181157-112181179 ATTATGAATAGTAAAGAGGAAGG + Intronic
960066102 3:113374790-113374812 AATAGAAAAAATTAGGTGGACGG - Intronic
961004297 3:123394565-123394587 TTTAGAAATAGCAAACTGGAAGG + Intronic
961083104 3:124043284-124043306 ATTAAAAATAGCAAGGTAGTTGG + Intergenic
963362872 3:144298830-144298852 ATTCCAAAAATTAAGGTGGAGGG - Intergenic
963736783 3:149026416-149026438 ATTAGAAAGTGTAAGATGGATGG - Intronic
964328236 3:155571693-155571715 ATTAGGAATAGAAAGATGGCCGG - Intronic
964390051 3:156187204-156187226 CTGAGAAATACCAAGGTGGAGGG - Intronic
964550117 3:157876232-157876254 AGCAGAAATAGTAAGGTAAAAGG - Intergenic
964687764 3:159416311-159416333 AATAAAATTAGTAAGGTAGATGG - Intronic
966809585 3:183831851-183831873 ATTAGAAACAGTAAAGAGAAAGG + Intronic
969963932 4:10975047-10975069 TTTAGAAATAGTCTTGTGGATGG - Intergenic
970162842 4:13206702-13206724 ATGAGAAATTGAGAGGTGGACGG - Intergenic
970272918 4:14366519-14366541 TTTAGAAATAGTAGGTGGGAAGG + Intergenic
970725017 4:19033627-19033649 GTTAGAAAGAGAAAGGTGGGGGG + Intergenic
971178673 4:24306794-24306816 AGTAGTAATAGGAAGGAGGAAGG + Intergenic
971580396 4:28331462-28331484 ATTAGAAAAGGTAAGATGAATGG + Intergenic
971645760 4:29200003-29200025 ATTAGAAATATAAATGTGAAAGG + Intergenic
972083941 4:35189837-35189859 ATTGTGAATAGTAAGGTGTATGG - Intergenic
973912683 4:55597986-55598008 GTTAAAAATAGTAAAGTAGAAGG - Intronic
975190446 4:71454483-71454505 ATAATATATAGTAAAGTGGAAGG - Intronic
975760803 4:77618040-77618062 ATAGGAAATTGTAAGGTGGGAGG - Intergenic
976560348 4:86493831-86493853 ATTGGAAAAAGAAAGGTAGAAGG - Intronic
977243224 4:94599312-94599334 TATAGAAATATTGAGGTGGAGGG + Intronic
977265534 4:94849199-94849221 ATGAGAAAAAGCAAGGTGTAGGG + Intronic
978796010 4:112708131-112708153 ATTAGAAATAGAAAAACGGAAGG + Intergenic
978883690 4:113740764-113740786 ATTAGAAATAGTGAGAAGGATGG - Intronic
978949929 4:114545773-114545795 ATGAGAGATGGCAAGGTGGAAGG + Intergenic
979873495 4:125856595-125856617 ATTGAACATAGTAAGGTTGAGGG - Intergenic
981406647 4:144378194-144378216 AATAGAAATAGTTAGGATGAAGG - Intergenic
987998819 5:25322718-25322740 AGTAGAAATAGTAAGTGTGATGG + Intergenic
988666391 5:33332784-33332806 ATTAGACATAGTCACGTGCATGG - Intergenic
989448774 5:41562646-41562668 ATTAGAAATAATAAGTTGTGAGG - Intergenic
989740142 5:44761065-44761087 ATTAAAAACAAAAAGGTGGAGGG + Intergenic
989748527 5:44861766-44861788 ATTAGAGTTAGTAAGGTAGGCGG - Intergenic
992275411 5:75111904-75111926 ATCAGAAATAGTGCAGTGGAAGG - Intronic
992953333 5:81882391-81882413 ACTAGAAAAAATAAGGGGGAGGG + Intergenic
993569731 5:89522353-89522375 TTTAAAAATAGTAAGGTGCTGGG + Intergenic
993646430 5:90469260-90469282 AAAAGAAATAGTAGGGTGGCTGG - Intronic
994602605 5:101925700-101925722 ATTATAAAGAGAAAGGTGAAAGG + Intergenic
994632022 5:102297644-102297666 ATTTGAACTCGGAAGGTGGAGGG + Intergenic
996312627 5:122123836-122123858 ATTAGAGATAGTAAGTTATAAGG - Intergenic
998233498 5:140377680-140377702 AATAGAAATAGAAAATTGGAGGG - Intergenic
1000545775 5:162599806-162599828 ATTAGAAATAGTAAATAAGAAGG - Intergenic
1001834351 5:174819244-174819266 TTTAAAAATATTAAGGGGGAGGG + Intergenic
1002844106 6:931130-931152 ATTAGAATTGGAAAGGTCGAGGG + Intergenic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003288420 6:4755987-4756009 AGGAGAAATAATAAGGAGGAGGG - Intronic
1003364536 6:5459784-5459806 GGAAGAAATAGGAAGGTGGAGGG - Intronic
1004138005 6:12987409-12987431 ATTTGTAATAGTTAGGTAGAAGG + Intronic
1005604912 6:27467104-27467126 ATTTGAACAAGTAAGGTGGTGGG - Intronic
1007294967 6:40814652-40814674 ATTAGAGAGAGGAAGTTGGAGGG - Intergenic
1007315679 6:40986752-40986774 AGGAGAAAAAGTGAGGTGGATGG + Intergenic
1010495061 6:76523914-76523936 ATTAGAAATAGTAAAGAAAATGG - Intergenic
1010535531 6:77024826-77024848 ATTAGAAAAAGTAAGTTTAACGG - Intergenic
1012254958 6:97020893-97020915 AATAGAGACAGCAAGGTGGAAGG - Intronic
1020290422 7:6718557-6718579 TTTGGAAATAGCAGGGTGGAGGG + Intergenic
1021609908 7:22446699-22446721 ATTAGAGTTAATAAGGTGAAGGG + Intronic
1021862095 7:24915934-24915956 ATTAGGAATAAATAGGTGGAGGG + Intronic
1022017232 7:26361076-26361098 AGTAGAAATAGTAATTTTGAGGG + Intronic
1024387820 7:48773705-48773727 ATAAGAAACAGTAAGGTAGCTGG - Intergenic
1025080120 7:55974546-55974568 ATTAGAAATACTATTGTAGAAGG + Intronic
1025278357 7:57605098-57605120 TTTCAAAATAGTAAGTTGGATGG + Intergenic
1027455039 7:78379704-78379726 ATTGGAAAGAGAAAGATGGATGG - Intronic
1028983270 7:96990202-96990224 ATTAGAAAGAGAAAGGCAGAGGG - Intergenic
1030297836 7:107946735-107946757 AATGGAAATATTAAGGTGGGTGG + Intronic
1030324957 7:108209431-108209453 AACAGAAATGGTATGGTGGATGG + Exonic
1032375276 7:131409286-131409308 ATTAGAAATAATAGGGAGCATGG + Intronic
1034066626 7:148143347-148143369 ATAAGAAATCCTAAGGTAGATGG + Intronic
1035931297 8:3783285-3783307 ATTAGAAATACTGGGATGGATGG + Intronic
1036098075 8:5746814-5746836 ACTAGAAATATTCAGGTAGAGGG - Intergenic
1038936515 8:32257844-32257866 ATAAGAAATAGTAATGTTTAGGG + Intronic
1039790755 8:40873795-40873817 GTTAAAAATAGTGAGGAGGACGG - Intronic
1040929877 8:52722292-52722314 ATTAGGGACAGTGAGGTGGAAGG - Intronic
1041540877 8:58983636-58983658 ATTTGACATTCTAAGGTGGATGG - Intronic
1044045948 8:87432237-87432259 AATAGAATTAGTAAGCTGGAAGG - Intronic
1044813965 8:96091623-96091645 ATTAGACAAAGCAAGTTGGAGGG + Intergenic
1045857431 8:106780628-106780650 ATTAGATTTAGCAATGTGGAAGG - Intergenic
1047143599 8:122171180-122171202 ATTAAAAATAGTTATGTGGTAGG + Intergenic
1047664319 8:127073917-127073939 ATTAGAAATAGGAATGCAGATGG + Intergenic
1048768584 8:137870379-137870401 ATTAGAAATAGTTTGGTGGCTGG + Intergenic
1050045853 9:1544550-1544572 AAGAGAAATCGCAAGGTGGATGG - Intergenic
1050259448 9:3826089-3826111 ATTTAAAATAGAAAGGGGGAAGG - Intronic
1050471833 9:6001178-6001200 AGTAGGAATAGAAAGGTGGATGG - Intronic
1052306315 9:27013913-27013935 ATTAAAAATAGTAAGGTAGTTGG + Intronic
1056463768 9:86834006-86834028 ATCAGAGACAGTAAGATGGATGG + Intergenic
1056975214 9:91246627-91246649 ATTAGAAATAGCATGCTAGAAGG + Intronic
1057841964 9:98493545-98493567 ATAAAAATCAGTAAGGTGGAGGG - Intronic
1057933166 9:99213383-99213405 AGTAGAAGTATTAAGGTGGAGGG + Intergenic
1058271909 9:102983623-102983645 ATTGGAAAGAGTAATGGGGATGG - Intergenic
1059583651 9:115580666-115580688 AATAGAAATAGATAGATGGATGG - Intergenic
1059688070 9:116656963-116656985 ATTAGAAACATTAAGGGAGAGGG + Intronic
1060646322 9:125283510-125283532 ATAATAAATAGCCAGGTGGAGGG - Intronic
1203629411 Un_KI270750v1:57659-57681 TTTCAAAATAGTAAGTTGGATGG + Intergenic
1186372093 X:8957321-8957343 ATTAGTAATAATAACTTGGAGGG + Intergenic
1187438880 X:19299163-19299185 ATTAGAAACAGCAAGGAGAATGG - Intergenic
1187919987 X:24192196-24192218 CTTAGCAATAGTGAGGTGTATGG + Intronic
1187943189 X:24401554-24401576 GTTAGAAATGTCAAGGTGGAAGG - Intergenic
1188327493 X:28823450-28823472 ATTAGAACTAAGAAGGGGGAAGG - Intronic
1188615103 X:32148233-32148255 CTTCTAAATAGTAAGGTAGATGG - Intronic
1189782760 X:44531990-44532012 TTTAGAAATAGTCTGTTGGAAGG - Intronic
1190532434 X:51393214-51393236 GTTAGAAATAGAATGGTGTATGG - Intergenic
1191914635 X:66188296-66188318 CTTAGCAATAGTAAGCTGAAAGG - Intronic
1192194072 X:69016971-69016993 AGAGGAAAGAGTAAGGTGGAGGG - Intergenic
1193355518 X:80515823-80515845 ATTAGACATAGAATGGTGGGAGG - Intergenic
1194712834 X:97256084-97256106 ATTAGAATTTGTCAGGTTGAGGG - Intronic
1194753698 X:97712522-97712544 ACTAGAAATAGGAAGGAGGGAGG + Intergenic
1196612054 X:117726719-117726741 ATTACAAATGGAAAGTTGGAAGG - Intergenic
1196726781 X:118902831-118902853 ATTAAAAATAGCGAGGTGTATGG + Intergenic
1199404264 X:147437653-147437675 ATTAGAAATAATAATTTTGAAGG + Intergenic
1200877823 Y:8177471-8177493 ATTAAATAAAGTAAAGTGGATGG - Intergenic
1201104794 Y:10755477-10755499 ATCAGAAATAGTGGAGTGGAAGG - Intergenic
1201180700 Y:11341584-11341606 ATTAAAAATAATATGGTAGAAGG - Intergenic