ID: 1102849098

View in Genome Browser
Species Human (GRCh38)
Location 12:116221875-116221897
Sequence TCAAATCCCCATAAGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102849095_1102849098 12 Left 1102849095 12:116221840-116221862 CCCTATTTAAAATAATATGAAAA 0: 1
1: 0
2: 12
3: 193
4: 2021
Right 1102849098 12:116221875-116221897 TCAAATCCCCATAAGGAGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 119
1102849096_1102849098 11 Left 1102849096 12:116221841-116221863 CCTATTTAAAATAATATGAAAAA 0: 1
1: 0
2: 24
3: 317
4: 2419
Right 1102849098 12:116221875-116221897 TCAAATCCCCATAAGGAGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102849098 Original CRISPR TCAAATCCCCATAAGGAGCA AGG Intronic
900355804 1:2262585-2262607 CCAAATCCAGATCAGGAGCAAGG - Intronic
902285143 1:15403431-15403453 TCAAATCCACAGAAGGGTCATGG - Intergenic
903055713 1:20634630-20634652 GCCAATCCCCATAGGGAGCCAGG - Intronic
904076934 1:27850278-27850300 TCAAGTCCACATCAGGGGCAAGG - Exonic
904247472 1:29198065-29198087 TTAGATTCTCATAAGGAGCATGG + Intronic
905184488 1:36186767-36186789 TGAAGTCCCCATGATGAGCATGG + Intergenic
907491881 1:54813868-54813890 TCACATCACAATAAGAAGCATGG + Exonic
908791778 1:67789908-67789930 TCAAAGCCCCAAAACTAGCATGG - Intronic
909609487 1:77537462-77537484 TCCATTCCCCATAAGGATGATGG - Intronic
919563703 1:199157416-199157438 TCAAATCCTGAAAAGGAGAAGGG + Intergenic
920266894 1:204730709-204730731 TCAAACCACCTTAGGGAGCATGG + Intergenic
922516181 1:226209848-226209870 TCAAATCACCAGAAGGAGAAGGG - Intergenic
1068807147 10:61209840-61209862 TATTATCACCATAAGGAGCATGG - Intergenic
1071378823 10:85037228-85037250 TCATATCCCCACAAGAGGCATGG + Intergenic
1072896511 10:99371988-99372010 TCAAATCCTCATAGGGAAAATGG + Intronic
1074038792 10:109767521-109767543 TGATATGCCCAAAAGGAGCAAGG + Intergenic
1076079638 10:127567379-127567401 TCCAATCCCCATCAGGGTCATGG + Intergenic
1077528313 11:3082274-3082296 TAAAATACCCAAAAGGAGGAGGG - Intergenic
1078949723 11:16116879-16116901 TTAGATTCTCATAAGGAGCATGG - Intronic
1081263625 11:40991686-40991708 TTAGATTCTCATAAGGAGCATGG + Intronic
1083312173 11:61789595-61789617 TCAAATCCGTATGAGGGGCAGGG + Intronic
1085964170 11:81500287-81500309 ACAAATCCCCATAGGGACAAAGG + Intergenic
1099167981 12:79329991-79330013 TTAAATCCCTATAAGGAGAGAGG + Intronic
1101083434 12:101211424-101211446 TCCAATTCCCAGAAGGATCAAGG - Intergenic
1102849098 12:116221875-116221897 TCAAATCCCCATAAGGAGCAAGG + Intronic
1106150404 13:27095037-27095059 TCTAAGCCTCATAAGTAGCAAGG - Intronic
1107027670 13:35819922-35819944 TCAAATCCCCTTAAAGATAAAGG + Intronic
1107205511 13:37781019-37781041 TCAAATGCCTATAAGGAGCCAGG + Intronic
1107441741 13:40433916-40433938 TTAGATTCTCATAAGGAGCATGG - Intergenic
1112611239 13:100956880-100956902 GCAATGCCCCATAAGGGGCATGG - Intergenic
1114430245 14:22654599-22654621 GCAGATCCCCAGAAGCAGCAGGG + Intergenic
1114590802 14:23863066-23863088 TCAAATTACCATGAGGAGCTAGG - Intergenic
1117143676 14:52815037-52815059 TAAAAACCCCAGAAGGATCAGGG - Intergenic
1121590488 14:95103022-95103044 TCATATCCCCCTCAGGATCAAGG + Intronic
1121817942 14:96942844-96942866 TCAAATCCACATAAGGCACTTGG - Intergenic
1125501711 15:40243865-40243887 TCCAGTCCCCAAAAGGAGTAGGG - Intronic
1128498726 15:68212367-68212389 TCAAATCTCCAGAAGTAGGAGGG - Intronic
1128534991 15:68483704-68483726 TCAAATCCTTAGAAGGAGCAAGG - Intergenic
1133058661 16:3160229-3160251 TCTAATTCCCATAGGGAGCAGGG - Intergenic
1138964728 16:62070629-62070651 TTAGATTCTCATAAGGAGCATGG + Intergenic
1143219272 17:5247883-5247905 TCAGATTCTCATAAGGAGCGCGG - Intergenic
1143277551 17:5722956-5722978 TCAAAGGCCTATAAGGAGCCTGG - Intergenic
1144136621 17:12301394-12301416 ACAAATCACCAAAAGGATCAGGG + Intergenic
1146287546 17:31584401-31584423 CCAAATACCCAAAAGGAGAAAGG - Intergenic
1149580728 17:57748737-57748759 CCCAATCCCCAAAAGGACCAAGG - Intergenic
1154298545 18:13172651-13172673 TCAAATCCCTATTAGCAGCCAGG - Intergenic
1166815297 19:45541173-45541195 TAAAAGCCCCATAATGAGGAGGG - Intronic
1167000208 19:46741360-46741382 TCACATCCTCATTAGGAGGAGGG - Intronic
1167200803 19:48063730-48063752 TTAAATCCCCAAAGGGAGGAGGG - Intronic
1168189456 19:54727175-54727197 CCCAATCCCCATCAGGAACAGGG + Intronic
1168206389 19:54853308-54853330 CCCAATCCCCATCAGGAACAGGG + Intronic
925801046 2:7600531-7600553 AAAAATCCCCACAAAGAGCAGGG + Intergenic
926082244 2:9996915-9996937 TGATATCCCCACAGGGAGCATGG - Intronic
926194424 2:10753975-10753997 CCAAAGCCTCATAAGGAGAATGG + Exonic
928614258 2:33020774-33020796 ACAAATACTCATAAGGAGGAAGG - Intronic
936104069 2:109609981-109610003 GCAATTCCTAATAAGGAGCATGG + Intronic
936243840 2:110809658-110809680 TCAAACCCCCATCAACAGCAGGG - Intronic
939850288 2:147296331-147296353 TGAAATTCCCATTAGGAGCTGGG + Intergenic
941029564 2:160494548-160494570 TCAACTCCCACTCAGGAGCAAGG + Intergenic
941958188 2:171226445-171226467 TGAAAACCCCATAAGAAACAGGG + Intronic
942414896 2:175748200-175748222 TCAAGTTCCCATTAGGAGTATGG - Intergenic
942855789 2:180545957-180545979 TCAAATCCAAATAATCAGCAAGG - Intergenic
944628936 2:201602448-201602470 TCAAATCTCCATAATGAGGCTGG + Intronic
1169997824 20:11578108-11578130 TCAAAGCACCACAAGGAGCTTGG + Intergenic
1173346596 20:42206089-42206111 GCAAATCCCTAGAAGAAGCATGG - Intronic
1173391686 20:42640836-42640858 TCAAATTCCCAGATGGAGTAAGG - Intronic
951809776 3:26686403-26686425 TGAAGTTACCATAAGGAGCATGG - Intronic
952305104 3:32138413-32138435 TCAGACCCCCATAAGGAATAAGG + Intronic
952497619 3:33929609-33929631 TCATATTCGCATAAGGGGCATGG - Intergenic
954601323 3:51872607-51872629 TCAAATCGCCAAAAGGTGAAAGG + Intergenic
955440817 3:58953014-58953036 TCAATTCCCAATAAGGACTATGG + Intronic
965133703 3:164734839-164734861 TCAAAAGCTCATAAGGAGAAAGG - Intergenic
965391650 3:168111497-168111519 TCAACTACTCATAAGAAGCAAGG - Intergenic
969643766 4:8414065-8414087 TCAATTCCCCATAAAGTTCATGG + Intronic
971022988 4:22557245-22557267 CCAAATCCCAATAAGGAAAACGG - Intergenic
971302825 4:25456062-25456084 AAAAATCCCAATGAGGAGCATGG - Intergenic
971380891 4:26096619-26096641 TCAGATCCACATTAGGAGGAAGG - Intergenic
971486312 4:27164093-27164115 CCTCATTCCCATAAGGAGCAGGG - Intergenic
974366611 4:60958214-60958236 TGAAATCCCAATAAGAAGAAGGG - Intergenic
979026797 4:115587839-115587861 TCAAATCCCACTTAGGAGTAAGG - Intergenic
982513466 4:156314622-156314644 TCAAATCTCAATAAGGACTATGG + Intergenic
985602945 5:844308-844330 TTTAATCCCCACAAGGAACAAGG + Intronic
986326831 5:6682125-6682147 TCAAATCCCTCACAGGAGCAGGG + Intergenic
987718185 5:21598249-21598271 TCATATGGCCAGAAGGAGCAAGG + Intergenic
990911728 5:60859246-60859268 TCAAATCCTCACAAAGGGCATGG - Intergenic
993916539 5:93750283-93750305 ACAAATCAGCATAAGTAGCAAGG - Intronic
998674259 5:144389441-144389463 TCAGGTTCTCATAAGGAGCATGG - Intronic
999001037 5:147922928-147922950 TCATCTCCGCTTAAGGAGCAGGG - Intergenic
1000374570 5:160567498-160567520 TCAAATCCCCACAATGGGCCAGG - Intronic
1001624639 5:173120995-173121017 TAAAATCCACATAAGAAGCCAGG - Intronic
1001730624 5:173953163-173953185 TAAAATACCCAAAAGGAGCTGGG + Exonic
1002560495 5:180078681-180078703 TTAGATTCTCATAAGGAGCACGG - Intergenic
1004168623 6:13278104-13278126 AGCAATCCCCATAAGGAGAAGGG + Intronic
1004837912 6:19548864-19548886 TTAAACCTCCAAAAGGAGCATGG - Intergenic
1006364551 6:33607781-33607803 TCCATTCCCCATCTGGAGCATGG + Intergenic
1014151382 6:118060066-118060088 TCAAAGCCACATAACAAGCAAGG + Intronic
1015433364 6:133155988-133156010 TCAAAACCTAATAAAGAGCAGGG - Intergenic
1020484102 7:8699836-8699858 ACAAATCACCATGAAGAGCAAGG - Intronic
1024514181 7:50230324-50230346 TCAAATGCTTATAAAGAGCATGG - Intergenic
1030177391 7:106668907-106668929 TTAGATTCTCATAAGGAGCATGG + Intergenic
1031038340 7:116812688-116812710 TCAAATAACCAAAAGGATCAGGG + Intronic
1031528163 7:122846660-122846682 TTACATCTCGATAAGGAGCAAGG + Intronic
1033455714 7:141501679-141501701 TGAAGTCCCCAGAAGGAGAAGGG + Intergenic
1035182239 7:157097769-157097791 TCAATTCCCCCTTAGGACCAGGG - Intergenic
1035432265 7:158830740-158830762 ACAAATGCCCAGAAGAAGCAGGG + Intergenic
1036514593 8:9432082-9432104 TGAAATCTCCCTAAAGAGCAAGG + Intergenic
1037311870 8:17564597-17564619 TTAGATTCTCATAAGGAGCATGG + Intronic
1038242151 8:25819783-25819805 TCACATCCCCATGAGAAGGAGGG + Intergenic
1038499472 8:28031504-28031526 TCAAATCCCTATAATGTGCCAGG + Intronic
1043661913 8:82753862-82753884 TCAAGTCCCACTAATGAGCAGGG - Intergenic
1044852203 8:96440151-96440173 TCAAATCTCCTTAATTAGCATGG - Intergenic
1047230633 8:122995344-122995366 TCAGATGCCGACAAGGAGCAGGG + Intergenic
1047717069 8:127605348-127605370 AGAAATGCCCATATGGAGCATGG - Intergenic
1052589783 9:30477132-30477154 TTAGATTCTCATAAGGAGCAAGG - Intergenic
1054328699 9:63730946-63730968 TCCAATCCCCACAAGGGGCTGGG - Intergenic
1058237084 9:102503596-102503618 TCAAATCCCAATAAGGTAGATGG + Intergenic
1189071050 X:37864690-37864712 TGTAAACCCCATAAGAAGCAGGG + Intronic
1190275161 X:48894434-48894456 TCAACTCCCCATAAAGATGAAGG - Intronic
1190332958 X:49247229-49247251 TCAAATGCCCATGAGAAGGATGG - Intronic
1190526925 X:51337634-51337656 TCAAATGCCCAAAAAGAGAAGGG + Intergenic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1197332142 X:125166739-125166761 TCAAATCCTTATAAGGAGTTTGG + Intergenic
1198151438 X:133914205-133914227 TCTAATCCCTATAACAAGCAAGG + Intronic
1200816972 Y:7543375-7543397 TTATATTCTCATAAGGAGCAAGG + Intergenic