ID: 1102854897

View in Genome Browser
Species Human (GRCh38)
Location 12:116285279-116285301
Sequence CTAAGTTTCTTACACATTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102854893_1102854897 28 Left 1102854893 12:116285228-116285250 CCAAAAAAGGGGTGAACTATATT No data
Right 1102854897 12:116285279-116285301 CTAAGTTTCTTACACATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102854897 Original CRISPR CTAAGTTTCTTACACATTGC AGG Intergenic
No off target data available for this crispr