ID: 1102855924

View in Genome Browser
Species Human (GRCh38)
Location 12:116293393-116293415
Sequence GGTCACCTACGCAGGCCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102855924_1102855931 13 Left 1102855924 12:116293393-116293415 CCAGTAGGCCTGCGTAGGTGACC No data
Right 1102855931 12:116293429-116293451 AAATGAGAACAAAAGGTAGTTGG No data
1102855924_1102855930 6 Left 1102855924 12:116293393-116293415 CCAGTAGGCCTGCGTAGGTGACC No data
Right 1102855930 12:116293422-116293444 GGGATCTAAATGAGAACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102855924 Original CRISPR GGTCACCTACGCAGGCCTAC TGG (reversed) Intergenic
No off target data available for this crispr