ID: 1102860045

View in Genome Browser
Species Human (GRCh38)
Location 12:116328302-116328324
Sequence TAGCATCCACACCATCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102860043_1102860045 -7 Left 1102860043 12:116328286-116328308 CCAAACCACAATGAGATAGCATC No data
Right 1102860045 12:116328302-116328324 TAGCATCCACACCATCAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102860045 Original CRISPR TAGCATCCACACCATCAGAA TGG Intergenic
No off target data available for this crispr