ID: 1102863148

View in Genome Browser
Species Human (GRCh38)
Location 12:116353840-116353862
Sequence GGACCTCAATGCTAGCAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102863147_1102863148 -7 Left 1102863147 12:116353824-116353846 CCTTGCTCAGACTTCAGGACCTC No data
Right 1102863148 12:116353840-116353862 GGACCTCAATGCTAGCAACTAGG No data
1102863145_1102863148 -2 Left 1102863145 12:116353819-116353841 CCTGGCCTTGCTCAGACTTCAGG No data
Right 1102863148 12:116353840-116353862 GGACCTCAATGCTAGCAACTAGG No data
1102863142_1102863148 21 Left 1102863142 12:116353796-116353818 CCCAGCATTGAATTAGATTTACA No data
Right 1102863148 12:116353840-116353862 GGACCTCAATGCTAGCAACTAGG No data
1102863143_1102863148 20 Left 1102863143 12:116353797-116353819 CCAGCATTGAATTAGATTTACAC No data
Right 1102863148 12:116353840-116353862 GGACCTCAATGCTAGCAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102863148 Original CRISPR GGACCTCAATGCTAGCAACT AGG Intergenic
No off target data available for this crispr