ID: 1102863809

View in Genome Browser
Species Human (GRCh38)
Location 12:116358816-116358838
Sequence CTCGGTTAGCCCTGAAATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102863809_1102863815 21 Left 1102863809 12:116358816-116358838 CCCAAATTTCAGGGCTAACCGAG No data
Right 1102863815 12:116358860-116358882 TTAAATCACTTGGGAAGCGCAGG No data
1102863809_1102863817 23 Left 1102863809 12:116358816-116358838 CCCAAATTTCAGGGCTAACCGAG No data
Right 1102863817 12:116358862-116358884 AAATCACTTGGGAAGCGCAGGGG No data
1102863809_1102863816 22 Left 1102863809 12:116358816-116358838 CCCAAATTTCAGGGCTAACCGAG No data
Right 1102863816 12:116358861-116358883 TAAATCACTTGGGAAGCGCAGGG No data
1102863809_1102863814 12 Left 1102863809 12:116358816-116358838 CCCAAATTTCAGGGCTAACCGAG No data
Right 1102863814 12:116358851-116358873 AATGGATAATTAAATCACTTGGG No data
1102863809_1102863813 11 Left 1102863809 12:116358816-116358838 CCCAAATTTCAGGGCTAACCGAG No data
Right 1102863813 12:116358850-116358872 GAATGGATAATTAAATCACTTGG No data
1102863809_1102863811 -6 Left 1102863809 12:116358816-116358838 CCCAAATTTCAGGGCTAACCGAG No data
Right 1102863811 12:116358833-116358855 ACCGAGTTGCAGTTAAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102863809 Original CRISPR CTCGGTTAGCCCTGAAATTT GGG (reversed) Intergenic
No off target data available for this crispr