ID: 1102864910

View in Genome Browser
Species Human (GRCh38)
Location 12:116366751-116366773
Sequence GGCCAGTGGCCATGCTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102864905_1102864910 21 Left 1102864905 12:116366707-116366729 CCGTATGCCATGCTGGGCATTCA No data
Right 1102864910 12:116366751-116366773 GGCCAGTGGCCATGCTGTGCTGG No data
1102864906_1102864910 14 Left 1102864906 12:116366714-116366736 CCATGCTGGGCATTCATAGCTGG No data
Right 1102864910 12:116366751-116366773 GGCCAGTGGCCATGCTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102864910 Original CRISPR GGCCAGTGGCCATGCTGTGC TGG Intergenic
No off target data available for this crispr