ID: 1102866810

View in Genome Browser
Species Human (GRCh38)
Location 12:116381345-116381367
Sequence GCACCGGGAACCTCCGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102866810_1102866815 0 Left 1102866810 12:116381345-116381367 CCTTCCACGGAGGTTCCCGGTGC No data
Right 1102866815 12:116381368-116381390 TCTGCATTACACCCCACAGGTGG No data
1102866810_1102866821 18 Left 1102866810 12:116381345-116381367 CCTTCCACGGAGGTTCCCGGTGC No data
Right 1102866821 12:116381386-116381408 GGTGGCTCTTGCCTGGCTTTGGG No data
1102866810_1102866822 19 Left 1102866810 12:116381345-116381367 CCTTCCACGGAGGTTCCCGGTGC No data
Right 1102866822 12:116381387-116381409 GTGGCTCTTGCCTGGCTTTGGGG No data
1102866810_1102866824 21 Left 1102866810 12:116381345-116381367 CCTTCCACGGAGGTTCCCGGTGC No data
Right 1102866824 12:116381389-116381411 GGCTCTTGCCTGGCTTTGGGGGG No data
1102866810_1102866826 28 Left 1102866810 12:116381345-116381367 CCTTCCACGGAGGTTCCCGGTGC No data
Right 1102866826 12:116381396-116381418 GCCTGGCTTTGGGGGGCTCAGGG No data
1102866810_1102866817 11 Left 1102866810 12:116381345-116381367 CCTTCCACGGAGGTTCCCGGTGC No data
Right 1102866817 12:116381379-116381401 CCCCACAGGTGGCTCTTGCCTGG No data
1102866810_1102866820 17 Left 1102866810 12:116381345-116381367 CCTTCCACGGAGGTTCCCGGTGC No data
Right 1102866820 12:116381385-116381407 AGGTGGCTCTTGCCTGGCTTTGG No data
1102866810_1102866823 20 Left 1102866810 12:116381345-116381367 CCTTCCACGGAGGTTCCCGGTGC No data
Right 1102866823 12:116381388-116381410 TGGCTCTTGCCTGGCTTTGGGGG No data
1102866810_1102866814 -3 Left 1102866810 12:116381345-116381367 CCTTCCACGGAGGTTCCCGGTGC No data
Right 1102866814 12:116381365-116381387 TGCTCTGCATTACACCCCACAGG No data
1102866810_1102866825 27 Left 1102866810 12:116381345-116381367 CCTTCCACGGAGGTTCCCGGTGC No data
Right 1102866825 12:116381395-116381417 TGCCTGGCTTTGGGGGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102866810 Original CRISPR GCACCGGGAACCTCCGTGGA AGG (reversed) Intergenic
No off target data available for this crispr