ID: 1102867702

View in Genome Browser
Species Human (GRCh38)
Location 12:116387090-116387112
Sequence CTGCATTGGGAGCCTGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102867702_1102867709 28 Left 1102867702 12:116387090-116387112 CCTTGGCCAGGCTCCCAATGCAG No data
Right 1102867709 12:116387141-116387163 CAATTATCACATCACTAATGAGG No data
1102867702_1102867710 29 Left 1102867702 12:116387090-116387112 CCTTGGCCAGGCTCCCAATGCAG No data
Right 1102867710 12:116387142-116387164 AATTATCACATCACTAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102867702 Original CRISPR CTGCATTGGGAGCCTGGCCA AGG (reversed) Intergenic
No off target data available for this crispr