ID: 1102868316

View in Genome Browser
Species Human (GRCh38)
Location 12:116392077-116392099
Sequence CAGGGTTTAAAAGGTATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102868316_1102868318 -6 Left 1102868316 12:116392077-116392099 CCAGAAATACCTTTTAAACCCTG No data
Right 1102868318 12:116392094-116392116 ACCCTGAGCAAATAAGCCAGAGG No data
1102868316_1102868321 0 Left 1102868316 12:116392077-116392099 CCAGAAATACCTTTTAAACCCTG No data
Right 1102868321 12:116392100-116392122 AGCAAATAAGCCAGAGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102868316 Original CRISPR CAGGGTTTAAAAGGTATTTC TGG (reversed) Intergenic
No off target data available for this crispr