ID: 1102868321

View in Genome Browser
Species Human (GRCh38)
Location 12:116392100-116392122
Sequence AGCAAATAAGCCAGAGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102868316_1102868321 0 Left 1102868316 12:116392077-116392099 CCAGAAATACCTTTTAAACCCTG No data
Right 1102868321 12:116392100-116392122 AGCAAATAAGCCAGAGGAGAAGG No data
1102868315_1102868321 1 Left 1102868315 12:116392076-116392098 CCCAGAAATACCTTTTAAACCCT No data
Right 1102868321 12:116392100-116392122 AGCAAATAAGCCAGAGGAGAAGG No data
1102868313_1102868321 15 Left 1102868313 12:116392062-116392084 CCTCTTAGCCAAAGCCCAGAAAT No data
Right 1102868321 12:116392100-116392122 AGCAAATAAGCCAGAGGAGAAGG No data
1102868314_1102868321 7 Left 1102868314 12:116392070-116392092 CCAAAGCCCAGAAATACCTTTTA No data
Right 1102868321 12:116392100-116392122 AGCAAATAAGCCAGAGGAGAAGG No data
1102868317_1102868321 -9 Left 1102868317 12:116392086-116392108 CCTTTTAAACCCTGAGCAAATAA No data
Right 1102868321 12:116392100-116392122 AGCAAATAAGCCAGAGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102868321 Original CRISPR AGCAAATAAGCCAGAGGAGA AGG Intergenic
No off target data available for this crispr