ID: 1102875429

View in Genome Browser
Species Human (GRCh38)
Location 12:116445132-116445154
Sequence GTGTCCAAGGGGGAGTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102875420_1102875429 9 Left 1102875420 12:116445100-116445122 CCTGACCTTGGGGAAGTGTTTTC No data
Right 1102875429 12:116445132-116445154 GTGTCCAAGGGGGAGTTGGCAGG No data
1102875419_1102875429 12 Left 1102875419 12:116445097-116445119 CCTCCTGACCTTGGGGAAGTGTT No data
Right 1102875429 12:116445132-116445154 GTGTCCAAGGGGGAGTTGGCAGG No data
1102875414_1102875429 30 Left 1102875414 12:116445079-116445101 CCTGGGAGACAAATATACCCTCC No data
Right 1102875429 12:116445132-116445154 GTGTCCAAGGGGGAGTTGGCAGG No data
1102875421_1102875429 4 Left 1102875421 12:116445105-116445127 CCTTGGGGAAGTGTTTTCCCTGC No data
Right 1102875429 12:116445132-116445154 GTGTCCAAGGGGGAGTTGGCAGG No data
1102875418_1102875429 13 Left 1102875418 12:116445096-116445118 CCCTCCTGACCTTGGGGAAGTGT No data
Right 1102875429 12:116445132-116445154 GTGTCCAAGGGGGAGTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102875429 Original CRISPR GTGTCCAAGGGGGAGTTGGC AGG Intergenic
No off target data available for this crispr