ID: 1102879496

View in Genome Browser
Species Human (GRCh38)
Location 12:116473519-116473541
Sequence CTGTATCCTCACATGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102879496_1102879499 10 Left 1102879496 12:116473519-116473541 CCTTCTTCCATGTGAGGATACAG No data
Right 1102879499 12:116473552-116473574 TCATCCTGCAAGTAAAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102879496 Original CRISPR CTGTATCCTCACATGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr