ID: 1102879875

View in Genome Browser
Species Human (GRCh38)
Location 12:116476143-116476165
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102879870_1102879875 20 Left 1102879870 12:116476100-116476122 CCAGTGGTGTTCAATTTAAGGGA No data
Right 1102879875 12:116476143-116476165 GTGTGTAAGGTAAAAGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102879875 Original CRISPR GTGTGTAAGGTAAAAGTGGA TGG Intergenic
No off target data available for this crispr