ID: 1102884101

View in Genome Browser
Species Human (GRCh38)
Location 12:116508676-116508698
Sequence GCGCGCCTGAGCAGCGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102884101_1102884108 7 Left 1102884101 12:116508676-116508698 CCAGGGCCGCTGCTCAGGCGCGC No data
Right 1102884108 12:116508706-116508728 CCAGGCTCCGCGCACCAGGCTGG No data
1102884101_1102884110 11 Left 1102884101 12:116508676-116508698 CCAGGGCCGCTGCTCAGGCGCGC No data
Right 1102884110 12:116508710-116508732 GCTCCGCGCACCAGGCTGGCGGG No data
1102884101_1102884106 3 Left 1102884101 12:116508676-116508698 CCAGGGCCGCTGCTCAGGCGCGC No data
Right 1102884106 12:116508702-116508724 GGAGCCAGGCTCCGCGCACCAGG No data
1102884101_1102884109 10 Left 1102884101 12:116508676-116508698 CCAGGGCCGCTGCTCAGGCGCGC No data
Right 1102884109 12:116508709-116508731 GGCTCCGCGCACCAGGCTGGCGG No data
1102884101_1102884111 12 Left 1102884101 12:116508676-116508698 CCAGGGCCGCTGCTCAGGCGCGC No data
Right 1102884111 12:116508711-116508733 CTCCGCGCACCAGGCTGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102884101 Original CRISPR GCGCGCCTGAGCAGCGGCCC TGG (reversed) Intergenic
No off target data available for this crispr