ID: 1102884527

View in Genome Browser
Species Human (GRCh38)
Location 12:116511506-116511528
Sequence CGTGCCCTGCTGAAAGTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102884527_1102884533 14 Left 1102884527 12:116511506-116511528 CCCTTGACTTTCAGCAGGGCACG No data
Right 1102884533 12:116511543-116511565 TTCAGACTAGTCTTGGCTTTTGG No data
1102884527_1102884532 7 Left 1102884527 12:116511506-116511528 CCCTTGACTTTCAGCAGGGCACG No data
Right 1102884532 12:116511536-116511558 TGGGGTTTTCAGACTAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102884527 Original CRISPR CGTGCCCTGCTGAAAGTCAA GGG (reversed) Intergenic
No off target data available for this crispr