ID: 1102886002

View in Genome Browser
Species Human (GRCh38)
Location 12:116522279-116522301
Sequence TTTGTCTTCCTGGAGACCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102886002_1102886007 16 Left 1102886002 12:116522279-116522301 CCTCTGGTCTCCAGGAAGACAAA No data
Right 1102886007 12:116522318-116522340 CCATCAGACTGAGCTGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102886002 Original CRISPR TTTGTCTTCCTGGAGACCAG AGG (reversed) Intergenic